Mutagenetix > Incidental Mutation

Incidental Mutation 'R1457:St3gal4'

158580

Institutional Source

Beutler Lab

Gene Symbol

St3gal4

Ensembl Gene

ENSMUSG00000032038

Gene Name

ST3 beta-galactoside alpha-2,3-sialyltransferase 4

Synonyms

ST3Gal IV, Siat4c

MMRRC Submission

039512-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R1457 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

35046576-35119268 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 35054757 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 24 (K24E)

Ref Sequence

ENSEMBL: ENSMUSP00000150187 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034537] [ENSMUST00000213526] [ENSMUST00000214526] [ENSMUST00000215089] [ENSMUST00000215463] [ENSMUST00000215638] [ENSMUST00000216557] [ENSMUST00000217149] [ENSMUST00000217542]

AlphaFold

Q91Y74

Predicted Effect

probably benign
Transcript: ENSMUST00000034537
AA Change: K43E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000034537
Gene: ENSMUSG00000032038
AA Change: K43E

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
Pfam:Glyco_transf_29	70	332	4.1e-59	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000213526
AA Change: K64E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Predicted Effect

probably benign
Transcript: ENSMUST00000214526
AA Change: K77E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

Predicted Effect

probably benign
Transcript: ENSMUST00000215089
AA Change: K64E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

Predicted Effect

probably benign
Transcript: ENSMUST00000215463
AA Change: K43E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

Predicted Effect

probably benign
Transcript: ENSMUST00000215638
AA Change: K75E

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

probably benign
Transcript: ENSMUST00000216557
AA Change: K80E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000217149
AA Change: K24E

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

Predicted Effect

probably benign
Transcript: ENSMUST00000217542
AA Change: K75E

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.7%
20x: 87.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 29 family, a group of enzymes involved in protein glycosylation. The encoded protein is targeted to Golgi membranes but may be proteolytically processed and secreted. The gene product may also be involved in the increased expression of sialyl Lewis X antigen seen in inflammatory responses. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygotes for a null allele show thrombocytopenia, altered platelet physiology, increased bleeding times, and abnormal leukocyte migration. Homozygotes for a different null allele fail to develop seizures in response to kindling, and show anxiety-like behaviors and altered sleep patterns. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	A	T	1: 37,626,012	Y268*	probably null	Het
Abca14	A	T	7: 120,289,460	I1210F	probably benign	Het
Ankrd17	T	C	5: 90,285,846	H688R	possibly damaging	Het
Arhgap24	T	A	5: 102,664,106	N66K	probably damaging	Het
Atp1a1	C	T	3: 101,590,466	G335D	probably damaging	Het
Cacna1g	C	T	11: 94,459,555	R488H	possibly damaging	Het
Cacna1h	A	T	17: 25,397,620	V149E	probably damaging	Het
Cd22	G	T	7: 30,873,170	P338Q	probably benign	Het
Cntln	G	T	4: 85,096,839	M1122I	probably benign	Het
Cntrl	A	G	2: 35,122,756	N302S	probably benign	Het
Cog8	T	C	8: 107,052,896	R250G	probably damaging	Het
Creld2	T	C	15: 88,823,753	C232R	probably damaging	Het
Cyp2b23	G	A	7: 26,673,149	P347L	probably damaging	Het
Dnah5	T	C	15: 28,403,542		probably null	Het
Eml6	C	T	11: 30,024,459	V40I	probably damaging	Het
Epb42	C	T	2: 121,029,967		probably null	Het
Fcrla	A	G	1: 170,921,004	L190P	probably damaging	Het
Galnt18	A	T	7: 111,779,428	Y40*	probably null	Het
Gdf7	A	T	12: 8,298,073	M416K	probably damaging	Het
Gm11232	T	A	4: 71,756,919		probably null	Het
Gpam	T	A	19: 55,088,176	N198Y	probably damaging	Het
Grip1	C	T	10: 119,986,350	S327F	possibly damaging	Het
Hey2	C	T	10: 30,834,356	A134T	probably benign	Het
Kat6a	T	C	8: 22,938,652	I1341T	probably benign	Het
Kcnd3	T	C	3: 105,668,186	L542P	probably benign	Het
Lars	G	A	18: 42,210,050	R1101C	probably damaging	Het
Lman2	T	C	13: 55,351,251	D234G	probably benign	Het
Map3k19	A	C	1: 127,817,898	I1273R	probably damaging	Het
Matn1	T	A	4: 130,950,019	F180I	possibly damaging	Het
Meikin	T	A	11: 54,370,941	L61*	probably null	Het
Mroh2b	G	T	15: 4,925,684	D720Y	probably damaging	Het
Myh13	T	C	11: 67,331,046	I199T	probably damaging	Het
Myh4	T	A	11: 67,248,461	S535T	probably damaging	Het
Myo5a	T	C	9: 75,213,065	M1715T	probably damaging	Het
Nat8	A	T	6: 85,830,989	V54D	probably damaging	Het
Nbea	A	G	3: 56,085,327	V286A	probably damaging	Het
Ndnf	A	G	6: 65,704,014	K426E	possibly damaging	Het
Nup210l	T	A	3: 90,190,972	N1410K	possibly damaging	Het
Oca2	A	T	7: 56,321,521	T399S	probably damaging	Het
Olfr1045	A	G	2: 86,198,252	S167P	probably damaging	Het
Olfr118	A	T	17: 37,672,925	K301*	probably null	Het
Olfr250	G	A	9: 38,368,196	V217I	probably benign	Het
Olfr366	A	C	2: 37,219,659	T57P	possibly damaging	Het
Olfr644	A	T	7: 104,068,459	C191S	probably damaging	Het
Olfr652	T	A	7: 104,565,071	N283K	probably damaging	Het
Otogl	A	C	10: 107,878,152		probably null	Het
Pde4b	C	T	4: 102,605,176	T511I	probably damaging	Het
Proser3	A	G	7: 30,539,747		probably null	Het
Psmd12	G	A	11: 107,479,646	V24M	probably damaging	Het
Rbm17	A	T	2: 11,593,461	M170K	probably benign	Het
Rims2	C	T	15: 39,511,314	T1064I	possibly damaging	Het
Ripor3	C	T	2: 167,992,653	V281M	probably damaging	Het
Rreb1	C	A	13: 37,946,928	Q1353K	possibly damaging	Het
Sgo2a	A	G	1: 58,015,806	D383G	probably benign	Het
Sik3	C	T	9: 46,221,148	T1346M	probably damaging	Het
Slx1b	A	T	7: 126,692,796	V63E	probably damaging	Het
Son	A	G	16: 91,657,086	D907G	probably damaging	Het
Src	G	A	2: 157,469,212	V401M	probably damaging	Het
Stat6	A	G	10: 127,658,245	K647R	probably damaging	Het
Tbl1xr1	G	A	3: 22,193,169		probably null	Het
Tlk2	G	A	11: 105,256,952		probably null	Het
Tmbim6	T	A	15: 99,401,615	I3K	probably benign	Het
Tmeff2	A	T	1: 51,181,867	I334F	probably damaging	Het
Ttn	T	C	2: 76,840,315		probably null	Het
Ubl7	T	A	9: 57,914,611	I81N	probably damaging	Het
Ugt1a10	A	G	1: 88,055,711	Y77C	probably damaging	Het
Uqcrfs1	A	G	13: 30,540,907	C217R	probably damaging	Het
Usp50	T	C	2: 126,761,634	T331A	probably benign	Het
Vmn1r65	A	G	7: 6,009,157	V26A	probably benign	Het
Wdfy3	A	C	5: 101,917,579	V1241G	possibly damaging	Het
Wtap	A	C	17: 12,981,744		probably null	Het
Zbtb40	C	A	4: 136,984,837	A1187S	possibly damaging	Het
Zfp57	T	C	17: 37,006,098	S20P	probably damaging	Het
Zfp592	A	G	7: 81,024,479	D397G	probably damaging	Het
Zfp747	A	T	7: 127,374,504	S165T	probably benign	Het
Zfp949	C	T	9: 88,569,838	T487I	probably damaging	Het
Zscan4d	A	G	7: 11,164,994	C119R	probably damaging	Het

Other mutations in St3gal4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00691:St3gal4	APN	9	35053069	unclassified	probably benign
IGL01448:St3gal4	APN	9	35052331	missense	probably benign	0.00
IGL01770:St3gal4	APN	9	35052305	missense	possibly damaging	0.73
IGL02862:St3gal4	APN	9	35052247	missense	probably benign	0.32
fuji	UTSW	9	35053173	nonsense	probably null
Granny_smith	UTSW	9	35053262	missense	probably damaging	1.00
Pomology	UTSW	9	35053079	missense	possibly damaging	0.67
R0362:St3gal4	UTSW	9	35053173	nonsense	probably null
R0863:St3gal4	UTSW	9	35053448	missense	probably damaging	1.00
R1530:St3gal4	UTSW	9	35052296	missense	probably benign	0.00
R4991:St3gal4	UTSW	9	35053136	missense	possibly damaging	0.93
R5452:St3gal4	UTSW	9	35053456	missense	probably damaging	1.00
R6277:St3gal4	UTSW	9	35053262	missense	probably damaging	1.00
R7564:St3gal4	UTSW	9	35052253	missense	probably benign	0.09
R7725:St3gal4	UTSW	9	35053079	missense	possibly damaging	0.67
R8080:St3gal4	UTSW	9	35106321	splice site	probably null
R8356:St3gal4	UTSW	9	35053142	missense	probably damaging	1.00
R8936:St3gal4	UTSW	9	35053427	missense	probably damaging	1.00
R8984:St3gal4	UTSW	9	35055648	missense	possibly damaging	0.90
R9258:St3gal4	UTSW	9	35052347	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGTCCCAAAGGGCAGCTCATAGG -3'
(R):5'- AGCCAGGCAGGAAACTTTTGAGAC -3'

Sequencing Primer
(F):5'- TGTTCCCTAGAACGGCTATACAG -3'
(R):5'- CTGTGATCTCCCACAGAGGAAATG -3'

Posted On

2014-03-14