Incidental Mutation 'R1457:Zfp949'
ID 158585
Institutional Source Beutler Lab
Gene Symbol Zfp949
Ensembl Gene ENSMUSG00000032425
Gene Name zinc finger protein 949
Synonyms 4930422I07Rik, Nczf
MMRRC Submission 039512-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R1457 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 88430073-88453114 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 88451891 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 487 (T487I)
Ref Sequence ENSEMBL: ENSMUSP00000125325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160652] [ENSMUST00000161458] [ENSMUST00000162827]
AlphaFold E9Q732
Predicted Effect probably benign
Transcript: ENSMUST00000160652
Predicted Effect probably damaging
Transcript: ENSMUST00000161458
AA Change: T487I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125017
Gene: ENSMUSG00000032425
AA Change: T487I

DomainStartEndE-ValueType
KRAB 8 68 2.63e-32 SMART
ZnF_C2H2 268 290 5.99e1 SMART
ZnF_C2H2 296 318 5.5e-3 SMART
ZnF_C2H2 324 346 6.42e-4 SMART
ZnF_C2H2 352 374 2.91e-2 SMART
ZnF_C2H2 380 402 4.11e-2 SMART
ZnF_C2H2 408 430 3.63e-3 SMART
ZnF_C2H2 436 458 5.67e-5 SMART
ZnF_C2H2 464 486 7.9e-4 SMART
ZnF_C2H2 492 514 2.43e-4 SMART
ZnF_C2H2 520 542 2.95e-3 SMART
ZnF_C2H2 548 570 1.03e-2 SMART
ZnF_C2H2 576 598 1.4e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162827
AA Change: T487I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125325
Gene: ENSMUSG00000032425
AA Change: T487I

DomainStartEndE-ValueType
KRAB 8 68 2.63e-32 SMART
ZnF_C2H2 268 290 5.99e1 SMART
ZnF_C2H2 296 318 5.5e-3 SMART
ZnF_C2H2 324 346 6.42e-4 SMART
ZnF_C2H2 352 374 2.91e-2 SMART
ZnF_C2H2 380 402 4.11e-2 SMART
ZnF_C2H2 408 430 3.63e-3 SMART
ZnF_C2H2 436 458 5.67e-5 SMART
ZnF_C2H2 464 486 7.9e-4 SMART
ZnF_C2H2 492 514 2.43e-4 SMART
ZnF_C2H2 520 542 2.95e-3 SMART
ZnF_C2H2 548 570 1.03e-2 SMART
ZnF_C2H2 576 598 1.4e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162985
SMART Domains Protein: ENSMUSP00000124007
Gene: ENSMUSG00000032425

DomainStartEndE-ValueType
KRAB 8 68 2.63e-32 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogenesis with defects in growth, development, cell proliferation, apoptosis and turning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 119,888,683 (GRCm39) I1210F probably benign Het
Ankrd17 T C 5: 90,433,705 (GRCm39) H688R possibly damaging Het
Arhgap24 T A 5: 102,811,972 (GRCm39) N66K probably damaging Het
Atp1a1 C T 3: 101,497,782 (GRCm39) G335D probably damaging Het
Cacna1g C T 11: 94,350,381 (GRCm39) R488H possibly damaging Het
Cacna1h A T 17: 25,616,594 (GRCm39) V149E probably damaging Het
Cd22 G T 7: 30,572,595 (GRCm39) P338Q probably benign Het
Cntln G T 4: 85,015,076 (GRCm39) M1122I probably benign Het
Cntrl A G 2: 35,012,768 (GRCm39) N302S probably benign Het
Cog8 T C 8: 107,779,528 (GRCm39) R250G probably damaging Het
Cracdl A T 1: 37,665,093 (GRCm39) Y268* probably null Het
Creld2 T C 15: 88,707,956 (GRCm39) C232R probably damaging Het
Cyp2b23 G A 7: 26,372,574 (GRCm39) P347L probably damaging Het
Dnah5 T C 15: 28,403,688 (GRCm39) probably null Het
Eml6 C T 11: 29,974,459 (GRCm39) V40I probably damaging Het
Epb42 C T 2: 120,860,448 (GRCm39) probably null Het
Fcrla A G 1: 170,748,573 (GRCm39) L190P probably damaging Het
Galnt18 A T 7: 111,378,635 (GRCm39) Y40* probably null Het
Gdf7 A T 12: 8,348,073 (GRCm39) M416K probably damaging Het
Gm11232 T A 4: 71,675,156 (GRCm39) probably null Het
Gpam T A 19: 55,076,608 (GRCm39) N198Y probably damaging Het
Grip1 C T 10: 119,822,255 (GRCm39) S327F possibly damaging Het
Hey2 C T 10: 30,710,352 (GRCm39) A134T probably benign Het
Kat6a T C 8: 23,428,668 (GRCm39) I1341T probably benign Het
Kcnd3 T C 3: 105,575,502 (GRCm39) L542P probably benign Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lman2 T C 13: 55,499,064 (GRCm39) D234G probably benign Het
Map3k19 A C 1: 127,745,635 (GRCm39) I1273R probably damaging Het
Matn1 T A 4: 130,677,330 (GRCm39) F180I possibly damaging Het
Meikin T A 11: 54,261,767 (GRCm39) L61* probably null Het
Mroh2b G T 15: 4,955,166 (GRCm39) D720Y probably damaging Het
Myh13 T C 11: 67,221,872 (GRCm39) I199T probably damaging Het
Myh4 T A 11: 67,139,287 (GRCm39) S535T probably damaging Het
Myo5a T C 9: 75,120,347 (GRCm39) M1715T probably damaging Het
Nat8 A T 6: 85,807,971 (GRCm39) V54D probably damaging Het
Nbea A G 3: 55,992,748 (GRCm39) V286A probably damaging Het
Ndnf A G 6: 65,680,998 (GRCm39) K426E possibly damaging Het
Nup210l T A 3: 90,098,279 (GRCm39) N1410K possibly damaging Het
Oca2 A T 7: 55,971,269 (GRCm39) T399S probably damaging Het
Or10al2 A T 17: 37,983,816 (GRCm39) K301* probably null Het
Or1af1 A C 2: 37,109,671 (GRCm39) T57P possibly damaging Het
Or51a43 A T 7: 103,717,666 (GRCm39) C191S probably damaging Het
Or52h7 T A 7: 104,214,278 (GRCm39) N283K probably damaging Het
Or8c10 G A 9: 38,279,492 (GRCm39) V217I probably benign Het
Or8j3 A G 2: 86,028,596 (GRCm39) S167P probably damaging Het
Otogl A C 10: 107,714,013 (GRCm39) probably null Het
Pde4b C T 4: 102,462,373 (GRCm39) T511I probably damaging Het
Proser3 A G 7: 30,239,172 (GRCm39) probably null Het
Psmd12 G A 11: 107,370,472 (GRCm39) V24M probably damaging Het
Rbm17 A T 2: 11,598,272 (GRCm39) M170K probably benign Het
Rims2 C T 15: 39,374,710 (GRCm39) T1064I possibly damaging Het
Ripor3 C T 2: 167,834,573 (GRCm39) V281M probably damaging Het
Rreb1 C A 13: 38,130,904 (GRCm39) Q1353K possibly damaging Het
Sgo2a A G 1: 58,054,965 (GRCm39) D383G probably benign Het
Sik3 C T 9: 46,132,446 (GRCm39) T1346M probably damaging Het
Slx1b A T 7: 126,291,968 (GRCm39) V63E probably damaging Het
Son A G 16: 91,453,974 (GRCm39) D907G probably damaging Het
Src G A 2: 157,311,132 (GRCm39) V401M probably damaging Het
St3gal4 T C 9: 34,966,053 (GRCm39) K24E possibly damaging Het
Stat6 A G 10: 127,494,114 (GRCm39) K647R probably damaging Het
Tbl1xr1 G A 3: 22,247,333 (GRCm39) probably null Het
Tlk2 G A 11: 105,147,778 (GRCm39) probably null Het
Tmbim6 T A 15: 99,299,496 (GRCm39) I3K probably benign Het
Tmeff2 A T 1: 51,221,026 (GRCm39) I334F probably damaging Het
Ttn T C 2: 76,670,659 (GRCm39) probably null Het
Ubl7 T A 9: 57,821,894 (GRCm39) I81N probably damaging Het
Ugt1a10 A G 1: 87,983,433 (GRCm39) Y77C probably damaging Het
Uqcrfs1 A G 13: 30,724,890 (GRCm39) C217R probably damaging Het
Usp50 T C 2: 126,603,554 (GRCm39) T331A probably benign Het
Vmn1r65 A G 7: 6,012,156 (GRCm39) V26A probably benign Het
Wdfy3 A C 5: 102,065,445 (GRCm39) V1241G possibly damaging Het
Wtap A C 17: 13,200,631 (GRCm39) probably null Het
Zbtb40 C A 4: 136,712,148 (GRCm39) A1187S possibly damaging Het
Zfp57 T C 17: 37,316,990 (GRCm39) S20P probably damaging Het
Zfp592 A G 7: 80,674,227 (GRCm39) D397G probably damaging Het
Zfp747 A T 7: 126,973,676 (GRCm39) S165T probably benign Het
Zscan4d A G 7: 10,898,921 (GRCm39) C119R probably damaging Het
Other mutations in Zfp949
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03201:Zfp949 APN 9 88,450,717 (GRCm39) missense probably benign 0.23
R0034:Zfp949 UTSW 9 88,449,693 (GRCm39) intron probably benign
R0462:Zfp949 UTSW 9 88,450,787 (GRCm39) missense possibly damaging 0.63
R1574:Zfp949 UTSW 9 88,451,830 (GRCm39) nonsense probably null
R1574:Zfp949 UTSW 9 88,451,830 (GRCm39) nonsense probably null
R1878:Zfp949 UTSW 9 88,451,356 (GRCm39) missense probably damaging 0.99
R1917:Zfp949 UTSW 9 88,452,115 (GRCm39) missense probably damaging 0.98
R4488:Zfp949 UTSW 9 88,452,142 (GRCm39) missense probably damaging 0.98
R4839:Zfp949 UTSW 9 88,452,047 (GRCm39) missense probably damaging 0.97
R5309:Zfp949 UTSW 9 88,449,236 (GRCm39) missense possibly damaging 0.92
R5312:Zfp949 UTSW 9 88,449,236 (GRCm39) missense possibly damaging 0.92
R5461:Zfp949 UTSW 9 88,451,537 (GRCm39) missense probably benign 0.00
R6530:Zfp949 UTSW 9 88,449,340 (GRCm39) critical splice donor site probably null
R6844:Zfp949 UTSW 9 88,451,464 (GRCm39) missense possibly damaging 0.91
R7749:Zfp949 UTSW 9 88,451,923 (GRCm39) missense probably damaging 1.00
R7937:Zfp949 UTSW 9 88,451,323 (GRCm39) missense probably damaging 1.00
R8150:Zfp949 UTSW 9 88,452,053 (GRCm39) missense probably benign
R8290:Zfp949 UTSW 9 88,451,293 (GRCm39) missense probably damaging 0.98
R8349:Zfp949 UTSW 9 88,449,302 (GRCm39) missense possibly damaging 0.84
R8449:Zfp949 UTSW 9 88,449,302 (GRCm39) missense possibly damaging 0.84
R8808:Zfp949 UTSW 9 88,451,417 (GRCm39) missense probably damaging 1.00
R8949:Zfp949 UTSW 9 88,450,771 (GRCm39) missense possibly damaging 0.78
R9219:Zfp949 UTSW 9 88,451,723 (GRCm39) missense probably damaging 1.00
R9396:Zfp949 UTSW 9 88,449,260 (GRCm39) missense probably damaging 0.99
R9486:Zfp949 UTSW 9 88,452,182 (GRCm39) missense probably benign 0.01
R9488:Zfp949 UTSW 9 88,452,182 (GRCm39) missense probably benign 0.01
R9643:Zfp949 UTSW 9 88,436,500 (GRCm39) start gained probably benign
R9727:Zfp949 UTSW 9 88,451,913 (GRCm39) nonsense probably null
R9778:Zfp949 UTSW 9 88,449,340 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCCTTGAAAGTAAGAAAACCTTTCCCA -3'
(R):5'- TTGCTGAGGACTAACTTCCACTGAAAC -3'

Sequencing Primer
(F):5'- ctcaaaacgcaccagagaac -3'
(R):5'- cgttttcccacatttattgcactc -3'
Posted On 2014-03-14