Incidental Mutation 'R1457:Hey2'
ID158586
Institutional Source Beutler Lab
Gene Symbol Hey2
Ensembl Gene ENSMUSG00000019789
Gene Namehairy/enhancer-of-split related with YRPW motif 2
SynonymsbHLHb32, Hesr2, CHF1, Herp1, Hrt2
MMRRC Submission 039512-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R1457 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location30832359-30842801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30834356 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 134 (A134T)
Ref Sequence ENSEMBL: ENSMUSP00000019924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019924]
Predicted Effect probably benign
Transcript: ENSMUST00000019924
AA Change: A134T

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000019924
Gene: ENSMUSG00000019789
AA Change: A134T

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
HLH 54 109 6.71e-16 SMART
ORANGE 119 166 5.55e-18 SMART
low complexity region 174 193 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 293 317 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hairy and enhancer of split-related (HESR) family of basic helix-loop-helix (bHLH)-type transcription factors. The encoded protein forms homo- or hetero-dimers that localize to the nucleus and interact with a histone deacetylase complex to repress transcription. Expression of this gene is induced by the Notch signal transduction pathway. Two similar and redundant genes in mouse are required for embryonic cardiovascular development, and are also implicated in neurogenesis and somitogenesis. Alternatively spliced transcript variants have been found, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac hypertrophy, ventricular septal defects, pulmonary and liver congestion, and reduced preweaning viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,626,012 Y268* probably null Het
Abca14 A T 7: 120,289,460 I1210F probably benign Het
Ankrd17 T C 5: 90,285,846 H688R possibly damaging Het
Arhgap24 T A 5: 102,664,106 N66K probably damaging Het
Atp1a1 C T 3: 101,590,466 G335D probably damaging Het
Cacna1g C T 11: 94,459,555 R488H possibly damaging Het
Cacna1h A T 17: 25,397,620 V149E probably damaging Het
Cd22 G T 7: 30,873,170 P338Q probably benign Het
Cntln G T 4: 85,096,839 M1122I probably benign Het
Cntrl A G 2: 35,122,756 N302S probably benign Het
Cog8 T C 8: 107,052,896 R250G probably damaging Het
Creld2 T C 15: 88,823,753 C232R probably damaging Het
Cyp2b23 G A 7: 26,673,149 P347L probably damaging Het
Dnah5 T C 15: 28,403,542 probably null Het
Eml6 C T 11: 30,024,459 V40I probably damaging Het
Epb42 C T 2: 121,029,967 probably null Het
Fcrla A G 1: 170,921,004 L190P probably damaging Het
Galnt18 A T 7: 111,779,428 Y40* probably null Het
Gdf7 A T 12: 8,298,073 M416K probably damaging Het
Gm11232 T A 4: 71,756,919 probably null Het
Gpam T A 19: 55,088,176 N198Y probably damaging Het
Grip1 C T 10: 119,986,350 S327F possibly damaging Het
Kat6a T C 8: 22,938,652 I1341T probably benign Het
Kcnd3 T C 3: 105,668,186 L542P probably benign Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lman2 T C 13: 55,351,251 D234G probably benign Het
Map3k19 A C 1: 127,817,898 I1273R probably damaging Het
Matn1 T A 4: 130,950,019 F180I possibly damaging Het
Meikin T A 11: 54,370,941 L61* probably null Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Myh13 T C 11: 67,331,046 I199T probably damaging Het
Myh4 T A 11: 67,248,461 S535T probably damaging Het
Myo5a T C 9: 75,213,065 M1715T probably damaging Het
Nat8 A T 6: 85,830,989 V54D probably damaging Het
Nbea A G 3: 56,085,327 V286A probably damaging Het
Ndnf A G 6: 65,704,014 K426E possibly damaging Het
Nup210l T A 3: 90,190,972 N1410K possibly damaging Het
Oca2 A T 7: 56,321,521 T399S probably damaging Het
Olfr1045 A G 2: 86,198,252 S167P probably damaging Het
Olfr118 A T 17: 37,672,925 K301* probably null Het
Olfr250 G A 9: 38,368,196 V217I probably benign Het
Olfr366 A C 2: 37,219,659 T57P possibly damaging Het
Olfr644 A T 7: 104,068,459 C191S probably damaging Het
Olfr652 T A 7: 104,565,071 N283K probably damaging Het
Otogl A C 10: 107,878,152 probably null Het
Pde4b C T 4: 102,605,176 T511I probably damaging Het
Proser3 A G 7: 30,539,747 probably null Het
Psmd12 G A 11: 107,479,646 V24M probably damaging Het
Rbm17 A T 2: 11,593,461 M170K probably benign Het
Rims2 C T 15: 39,511,314 T1064I possibly damaging Het
Ripor3 C T 2: 167,992,653 V281M probably damaging Het
Rreb1 C A 13: 37,946,928 Q1353K possibly damaging Het
Sgo2a A G 1: 58,015,806 D383G probably benign Het
Sik3 C T 9: 46,221,148 T1346M probably damaging Het
Slx1b A T 7: 126,692,796 V63E probably damaging Het
Son A G 16: 91,657,086 D907G probably damaging Het
Src G A 2: 157,469,212 V401M probably damaging Het
St3gal4 T C 9: 35,054,757 K24E possibly damaging Het
Stat6 A G 10: 127,658,245 K647R probably damaging Het
Tbl1xr1 G A 3: 22,193,169 probably null Het
Tlk2 G A 11: 105,256,952 probably null Het
Tmbim6 T A 15: 99,401,615 I3K probably benign Het
Tmeff2 A T 1: 51,181,867 I334F probably damaging Het
Ttn T C 2: 76,840,315 probably null Het
Ubl7 T A 9: 57,914,611 I81N probably damaging Het
Ugt1a10 A G 1: 88,055,711 Y77C probably damaging Het
Uqcrfs1 A G 13: 30,540,907 C217R probably damaging Het
Usp50 T C 2: 126,761,634 T331A probably benign Het
Vmn1r65 A G 7: 6,009,157 V26A probably benign Het
Wdfy3 A C 5: 101,917,579 V1241G possibly damaging Het
Wtap A C 17: 12,981,744 probably null Het
Zbtb40 C A 4: 136,984,837 A1187S possibly damaging Het
Zfp57 T C 17: 37,006,098 S20P probably damaging Het
Zfp592 A G 7: 81,024,479 D397G probably damaging Het
Zfp747 A T 7: 127,374,504 S165T probably benign Het
Zfp949 C T 9: 88,569,838 T487I probably damaging Het
Zscan4d A G 7: 11,164,994 C119R probably damaging Het
Other mutations in Hey2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01681:Hey2 APN 10 30834137 missense probably benign 0.25
IGL02525:Hey2 APN 10 30842647 start codon destroyed probably null 0.99
R0167:Hey2 UTSW 10 30840665 missense probably benign 0.04
R0279:Hey2 UTSW 10 30834010 missense probably damaging 0.97
R0553:Hey2 UTSW 10 30840489 splice site probably benign
R0592:Hey2 UTSW 10 30833957 missense probably benign 0.44
R0621:Hey2 UTSW 10 30834386 missense probably benign 0.36
R1437:Hey2 UTSW 10 30833849 missense probably benign 0.00
R2449:Hey2 UTSW 10 30840446 missense possibly damaging 0.94
R4721:Hey2 UTSW 10 30834308 missense possibly damaging 0.65
R4755:Hey2 UTSW 10 30834304 missense probably benign 0.00
R4828:Hey2 UTSW 10 30834183 missense possibly damaging 0.95
R5419:Hey2 UTSW 10 30834023 missense probably benign
R6927:Hey2 UTSW 10 30834417 missense probably benign 0.16
R7079:Hey2 UTSW 10 30834386 missense probably benign 0.36
R8196:Hey2 UTSW 10 30834277 missense probably benign
R8238:Hey2 UTSW 10 30840663 missense probably benign
R8381:Hey2 UTSW 10 30833990 missense probably damaging 1.00
R8383:Hey2 UTSW 10 30840669 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCACTTCTGAAGATGTGGATAGGC -3'
(R):5'- AATATGCACTTGGCTGGACAGGTC -3'

Sequencing Primer
(F):5'- TCCATTGGGCTGGAGCAG -3'
(R):5'- GTGTTTTCAGAAAGAGTCATCCC -3'
Posted On2014-03-14