Mutagenetix > Incidental Mutation

Incidental Mutation 'R1457:Grip1'

158588

Institutional Source

Beutler Lab

Gene Symbol

Grip1

Ensembl Gene

ENSMUSG00000034813

Gene Name

glutamate receptor interacting protein 1

Synonyms

MMRRC Submission

039512-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1457 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

119453830-120087261 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 119986350 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Phenylalanine at position 327 (S327F)

Ref Sequence

ENSEMBL: ENSMUSP00000121670 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041962] [ENSMUST00000077871] [ENSMUST00000105262] [ENSMUST00000138410] [ENSMUST00000144825] [ENSMUST00000144959] [ENSMUST00000147356] [ENSMUST00000147454] [ENSMUST00000148954]

AlphaFold

Q925T6

Predicted Effect

probably benign
Transcript: ENSMUST00000041962
AA Change: S355F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000042436
Gene: ENSMUSG00000034813
AA Change: S355F

Domain	Start	End	E-Value	Type
PDZ	63	137	4.86e-13	SMART
PDZ	161	239	6.4e-22	SMART
PDZ	262	337	1.97e-13	SMART
low complexity region	354	367	N/A	INTRINSIC
low complexity region	388	405	N/A	INTRINSIC
low complexity region	413	424	N/A	INTRINSIC
PDZ	429	509	6.36e-17	SMART
PDZ	530	606	1.11e-16	SMART
PDZ	629	703	1.73e-18	SMART
PDZ	947	1019	2.79e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000077871
AA Change: S328F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000077033
Gene: ENSMUSG00000034813
AA Change: S328F

Domain	Start	End	E-Value	Type
PDZ	36	110	4.86e-13	SMART
PDZ	134	212	6.4e-22	SMART
PDZ	235	310	1.97e-13	SMART
low complexity region	327	340	N/A	INTRINSIC
low complexity region	361	378	N/A	INTRINSIC
low complexity region	386	397	N/A	INTRINSIC
PDZ	402	482	6.36e-17	SMART
PDZ	503	579	1.11e-16	SMART
PDZ	602	676	1.73e-18	SMART
PDZ	920	992	2.79e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105262
AA Change: S354F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000100897
Gene: ENSMUSG00000034813
AA Change: S354F

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	353	366	N/A	INTRINSIC
low complexity region	387	404	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
PDZ	428	508	6.36e-17	SMART
PDZ	529	605	1.11e-16	SMART
PDZ	628	702	1.73e-18	SMART
PDZ	946	1018	2.79e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127787

Predicted Effect

probably benign
Transcript: ENSMUST00000138410
AA Change: S406F

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000123234
Gene: ENSMUSG00000034813
AA Change: S406F

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	393	421	N/A	INTRINSIC
low complexity region	439	456	N/A	INTRINSIC
low complexity region	464	475	N/A	INTRINSIC
PDZ	480	560	6.36e-17	SMART
PDZ	581	657	1.11e-16	SMART
PDZ	680	754	1.73e-18	SMART
PDZ	1013	1085	2.79e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139352

Predicted Effect

possibly damaging
Transcript: ENSMUST00000144825
AA Change: S327F

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000121670
Gene: ENSMUSG00000034813
AA Change: S327F

Domain	Start	End	E-Value	Type
PDZ	35	109	4.86e-13	SMART
PDZ	133	211	6.4e-22	SMART
PDZ	234	309	1.97e-13	SMART
low complexity region	326	339	N/A	INTRINSIC
low complexity region	360	377	N/A	INTRINSIC
low complexity region	385	396	N/A	INTRINSIC
PDZ	401	481	6.36e-17	SMART
PDZ	502	578	1.11e-16	SMART
PDZ	601	675	1.73e-18	SMART
PDZ	919	991	2.79e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000144959
AA Change: S406F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000122323
Gene: ENSMUSG00000034813
AA Change: S406F

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	393	421	N/A	INTRINSIC
low complexity region	439	456	N/A	INTRINSIC
low complexity region	464	475	N/A	INTRINSIC
PDZ	480	560	6.36e-17	SMART
PDZ	581	657	1.11e-16	SMART
PDZ	680	754	1.73e-18	SMART
PDZ	998	1070	2.79e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000147356
AA Change: S407F

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000115478
Gene: ENSMUSG00000034813
AA Change: S407F

Domain	Start	End	E-Value	Type
PDZ	63	137	4.86e-13	SMART
PDZ	161	239	6.4e-22	SMART
PDZ	262	337	1.97e-13	SMART
low complexity region	394	422	N/A	INTRINSIC
low complexity region	440	457	N/A	INTRINSIC
low complexity region	465	476	N/A	INTRINSIC
PDZ	481	561	6.36e-17	SMART
PDZ	582	658	1.11e-16	SMART
PDZ	681	755	1.73e-18	SMART
PDZ	999	1071	2.79e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000147454
AA Change: S406F

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000118073
Gene: ENSMUSG00000034813
AA Change: S406F

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	393	421	N/A	INTRINSIC
low complexity region	439	456	N/A	INTRINSIC
low complexity region	464	475	N/A	INTRINSIC
PDZ	480	560	6.36e-17	SMART
PDZ	581	657	1.11e-16	SMART
PDZ	680	754	1.73e-18	SMART
PDZ	998	1070	2.79e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147598

Predicted Effect

probably benign
Transcript: ENSMUST00000148954
AA Change: S354F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000118397
Gene: ENSMUSG00000034813
AA Change: S354F

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	353	366	N/A	INTRINSIC
low complexity region	387	404	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
PDZ	428	508	6.36e-17	SMART
PDZ	529	605	1.11e-16	SMART
PDZ	628	702	1.73e-18	SMART
PDZ	961	1033	2.79e-13	SMART

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.7%
20x: 87.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein containing multiple PDZ (post synaptic density protein, Drosophila disc large tumor suppressor, and zonula occludens-1 protein) domains. The encoded protein acts as a mediator between cytoskeletal and membrane proteins, particularly in neuronal cells, and facilitates complex formation at the cell membrane. Mutation of this gene can cause embryonic lethality resulting from defects of the dermo-epidermal junction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous ablation of gene function results in embryonic lethality and blistering skin lesions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	A	T	1: 37,626,012	Y268*	probably null	Het
Abca14	A	T	7: 120,289,460	I1210F	probably benign	Het
Ankrd17	T	C	5: 90,285,846	H688R	possibly damaging	Het
Arhgap24	T	A	5: 102,664,106	N66K	probably damaging	Het
Atp1a1	C	T	3: 101,590,466	G335D	probably damaging	Het
Cacna1g	C	T	11: 94,459,555	R488H	possibly damaging	Het
Cacna1h	A	T	17: 25,397,620	V149E	probably damaging	Het
Cd22	G	T	7: 30,873,170	P338Q	probably benign	Het
Cntln	G	T	4: 85,096,839	M1122I	probably benign	Het
Cntrl	A	G	2: 35,122,756	N302S	probably benign	Het
Cog8	T	C	8: 107,052,896	R250G	probably damaging	Het
Creld2	T	C	15: 88,823,753	C232R	probably damaging	Het
Cyp2b23	G	A	7: 26,673,149	P347L	probably damaging	Het
Dnah5	T	C	15: 28,403,542		probably null	Het
Eml6	C	T	11: 30,024,459	V40I	probably damaging	Het
Epb42	C	T	2: 121,029,967		probably null	Het
Fcrla	A	G	1: 170,921,004	L190P	probably damaging	Het
Galnt18	A	T	7: 111,779,428	Y40*	probably null	Het
Gdf7	A	T	12: 8,298,073	M416K	probably damaging	Het
Gm11232	T	A	4: 71,756,919		probably null	Het
Gpam	T	A	19: 55,088,176	N198Y	probably damaging	Het
Hey2	C	T	10: 30,834,356	A134T	probably benign	Het
Kat6a	T	C	8: 22,938,652	I1341T	probably benign	Het
Kcnd3	T	C	3: 105,668,186	L542P	probably benign	Het
Lars	G	A	18: 42,210,050	R1101C	probably damaging	Het
Lman2	T	C	13: 55,351,251	D234G	probably benign	Het
Map3k19	A	C	1: 127,817,898	I1273R	probably damaging	Het
Matn1	T	A	4: 130,950,019	F180I	possibly damaging	Het
Meikin	T	A	11: 54,370,941	L61*	probably null	Het
Mroh2b	G	T	15: 4,925,684	D720Y	probably damaging	Het
Myh13	T	C	11: 67,331,046	I199T	probably damaging	Het
Myh4	T	A	11: 67,248,461	S535T	probably damaging	Het
Myo5a	T	C	9: 75,213,065	M1715T	probably damaging	Het
Nat8	A	T	6: 85,830,989	V54D	probably damaging	Het
Nbea	A	G	3: 56,085,327	V286A	probably damaging	Het
Ndnf	A	G	6: 65,704,014	K426E	possibly damaging	Het
Nup210l	T	A	3: 90,190,972	N1410K	possibly damaging	Het
Oca2	A	T	7: 56,321,521	T399S	probably damaging	Het
Olfr1045	A	G	2: 86,198,252	S167P	probably damaging	Het
Olfr118	A	T	17: 37,672,925	K301*	probably null	Het
Olfr250	G	A	9: 38,368,196	V217I	probably benign	Het
Olfr366	A	C	2: 37,219,659	T57P	possibly damaging	Het
Olfr644	A	T	7: 104,068,459	C191S	probably damaging	Het
Olfr652	T	A	7: 104,565,071	N283K	probably damaging	Het
Otogl	A	C	10: 107,878,152		probably null	Het
Pde4b	C	T	4: 102,605,176	T511I	probably damaging	Het
Proser3	A	G	7: 30,539,747		probably null	Het
Psmd12	G	A	11: 107,479,646	V24M	probably damaging	Het
Rbm17	A	T	2: 11,593,461	M170K	probably benign	Het
Rims2	C	T	15: 39,511,314	T1064I	possibly damaging	Het
Ripor3	C	T	2: 167,992,653	V281M	probably damaging	Het
Rreb1	C	A	13: 37,946,928	Q1353K	possibly damaging	Het
Sgo2a	A	G	1: 58,015,806	D383G	probably benign	Het
Sik3	C	T	9: 46,221,148	T1346M	probably damaging	Het
Slx1b	A	T	7: 126,692,796	V63E	probably damaging	Het
Son	A	G	16: 91,657,086	D907G	probably damaging	Het
Src	G	A	2: 157,469,212	V401M	probably damaging	Het
St3gal4	T	C	9: 35,054,757	K24E	possibly damaging	Het
Stat6	A	G	10: 127,658,245	K647R	probably damaging	Het
Tbl1xr1	G	A	3: 22,193,169		probably null	Het
Tlk2	G	A	11: 105,256,952		probably null	Het
Tmbim6	T	A	15: 99,401,615	I3K	probably benign	Het
Tmeff2	A	T	1: 51,181,867	I334F	probably damaging	Het
Ttn	T	C	2: 76,840,315		probably null	Het
Ubl7	T	A	9: 57,914,611	I81N	probably damaging	Het
Ugt1a10	A	G	1: 88,055,711	Y77C	probably damaging	Het
Uqcrfs1	A	G	13: 30,540,907	C217R	probably damaging	Het
Usp50	T	C	2: 126,761,634	T331A	probably benign	Het
Vmn1r65	A	G	7: 6,009,157	V26A	probably benign	Het
Wdfy3	A	C	5: 101,917,579	V1241G	possibly damaging	Het
Wtap	A	C	17: 12,981,744		probably null	Het
Zbtb40	C	A	4: 136,984,837	A1187S	possibly damaging	Het
Zfp57	T	C	17: 37,006,098	S20P	probably damaging	Het
Zfp592	A	G	7: 81,024,479	D397G	probably damaging	Het
Zfp747	A	T	7: 127,374,504	S165T	probably benign	Het
Zfp949	C	T	9: 88,569,838	T487I	probably damaging	Het
Zscan4d	A	G	7: 11,164,994	C119R	probably damaging	Het

Other mutations in Grip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01309:Grip1	APN	10	119931302	nonsense	probably null
IGL01374:Grip1	APN	10	120049368	missense	probably benign	0.03
IGL01592:Grip1	APN	10	119930003	missense	probably damaging	1.00
IGL02207:Grip1	APN	10	120075309	missense	probably damaging	1.00
IGL02222:Grip1	APN	10	119999809	missense	probably damaging	1.00
IGL02225:Grip1	APN	10	120049453	missense	probably damaging	1.00
IGL02447:Grip1	APN	10	120020071	missense	probably damaging	1.00
IGL02492:Grip1	APN	10	119930040	splice site	probably benign
IGL02522:Grip1	APN	10	119931249	missense	probably damaging	1.00
IGL02574:Grip1	APN	10	119942913	missense	probably damaging	1.00
IGL02718:Grip1	APN	10	120075515	makesense	probably null
IGL02751:Grip1	APN	10	119978577	missense	probably benign	0.08
IGL03221:Grip1	APN	10	119986394	missense	probably benign	0.00
IGL03377:Grip1	APN	10	120055032	missense	probably damaging	0.98
PIT4403001:Grip1	UTSW	10	119929928	missense	probably damaging	1.00
R0304:Grip1	UTSW	10	120075471	missense	probably benign	0.31
R0681:Grip1	UTSW	10	120010230	missense	probably damaging	1.00
R0760:Grip1	UTSW	10	120018078	missense	probably damaging	0.96
R1506:Grip1	UTSW	10	119978451	missense	probably damaging	1.00
R1541:Grip1	UTSW	10	120000543	missense	probably damaging	0.99
R1553:Grip1	UTSW	10	120054851	missense	probably damaging	1.00
R1709:Grip1	UTSW	10	119897715	missense	probably damaging	0.98
R2055:Grip1	UTSW	10	120049511	splice site	probably benign
R2059:Grip1	UTSW	10	120038698	missense	possibly damaging	0.80
R2261:Grip1	UTSW	10	119985584	missense	probably benign	0.00
R2475:Grip1	UTSW	10	119978496	missense	probably benign	0.01
R3777:Grip1	UTSW	10	119985630	critical splice donor site	probably null
R3849:Grip1	UTSW	10	119929958	missense	probably damaging	1.00
R3956:Grip1	UTSW	10	119930026	missense	probably damaging	1.00
R4643:Grip1	UTSW	10	120020101	missense	probably damaging	1.00
R4693:Grip1	UTSW	10	120000554	missense	probably benign	0.10
R4724:Grip1	UTSW	10	120038683	missense	probably benign	0.02
R4843:Grip1	UTSW	10	119930015	missense	probably damaging	1.00
R4884:Grip1	UTSW	10	120075306	missense	probably damaging	1.00
R4912:Grip1	UTSW	10	119931248	missense	probably damaging	1.00
R5185:Grip1	UTSW	10	119931259	missense	probably benign	0.37
R5291:Grip1	UTSW	10	120086969	missense	probably benign	0.04
R5293:Grip1	UTSW	10	119897735	missense	probably damaging	0.99
R5296:Grip1	UTSW	10	119929928	missense	probably damaging	1.00
R5302:Grip1	UTSW	10	120020077	missense	probably damaging	1.00
R5541:Grip1	UTSW	10	120072718	missense	probably damaging	1.00
R5792:Grip1	UTSW	10	119985480	missense	probably benign	0.07
R5861:Grip1	UTSW	10	119929970	missense	probably damaging	1.00
R5905:Grip1	UTSW	10	119985492	missense	probably benign	0.02
R5949:Grip1	UTSW	10	120050242	missense	probably benign	0.00
R6112:Grip1	UTSW	10	119993232	missense	probably benign	0.00
R6166:Grip1	UTSW	10	120072718	missense	probably damaging	1.00
R6167:Grip1	UTSW	10	119897797	critical splice donor site	probably null
R6193:Grip1	UTSW	10	120038314	missense	probably damaging	1.00
R6218:Grip1	UTSW	10	119986346	missense	possibly damaging	0.95
R6267:Grip1	UTSW	10	120075464	nonsense	probably null
R6296:Grip1	UTSW	10	120075464	nonsense	probably null
R6490:Grip1	UTSW	10	119986424	missense	possibly damaging	0.82
R6543:Grip1	UTSW	10	119985594	missense	probably benign	0.00
R6558:Grip1	UTSW	10	119454383	missense	probably benign	0.00
R6995:Grip1	UTSW	10	119986470	missense	probably damaging	0.99
R7122:Grip1	UTSW	10	120035374	missense	possibly damaging	0.48
R7157:Grip1	UTSW	10	119945156	missense	probably damaging	1.00
R7410:Grip1	UTSW	10	120020020	missense	probably benign	0.01
R7447:Grip1	UTSW	10	120086966	missense	probably benign	0.01
R7539:Grip1	UTSW	10	120054871	missense	probably benign	0.17
R7586:Grip1	UTSW	10	120077138	splice site	probably null
R7768:Grip1	UTSW	10	120038397	missense	probably damaging	0.98
R7831:Grip1	UTSW	10	120018106	missense	probably damaging	1.00
R7896:Grip1	UTSW	10	119978545	missense	possibly damaging	0.53
R8103:Grip1	UTSW	10	119978535	missense	probably benign	0.00
R8254:Grip1	UTSW	10	120054905	nonsense	probably null
R8688:Grip1	UTSW	10	119999904	missense	probably benign	0.12
R8823:Grip1	UTSW	10	119975951	missense
R8837:Grip1	UTSW	10	119930035	missense	probably damaging	1.00
R8885:Grip1	UTSW	10	119454287	start gained	probably benign
R8951:Grip1	UTSW	10	120038604	missense	possibly damaging	0.85
R9042:Grip1	UTSW	10	120000533	missense	probably benign	0.14
R9045:Grip1	UTSW	10	120035451	missense	probably damaging	0.97
R9237:Grip1	UTSW	10	120075405	missense	probably benign	0.07
R9254:Grip1	UTSW	10	119945056	missense	probably damaging	1.00
R9259:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9260:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9307:Grip1	UTSW	10	119985549	missense	probably benign	0.01
R9379:Grip1	UTSW	10	119945056	missense	probably damaging	1.00
R9546:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9547:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9548:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9549:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9583:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9584:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9610:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9611:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9612:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9684:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9687:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9690:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9691:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9742:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9744:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9752:Grip1	UTSW	10	120035351	missense	possibly damaging	0.46
R9758:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9762:Grip1	UTSW	10	119976001	missense	possibly damaging	0.92
R9764:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
RF011:Grip1	UTSW	10	119931315	missense	probably null	0.97
Z1176:Grip1	UTSW	10	119819483	unclassified	probably benign
Z1177:Grip1	UTSW	10	119986444	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TCAGGGGACACCTCAGAACATTGG -3'
(R):5'- ACACAGCAACTGTCAGATTACCGTC -3'

Sequencing Primer
(F):5'- AAATGACACTGTGTGCCTGATG -3'
(R):5'- GCATCTTCTGGAGACCAAATG -3'

Posted On

2014-03-14