Incidental Mutation 'R1457:Grip1'
ID 158588
Institutional Source Beutler Lab
Gene Symbol Grip1
Ensembl Gene ENSMUSG00000034813
Gene Name glutamate receptor interacting protein 1
Synonyms 4931400F03Rik, eb
MMRRC Submission 039512-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1457 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 119289810-119923172 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 119822255 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Phenylalanine at position 327 (S327F)
Ref Sequence ENSEMBL: ENSMUSP00000121670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041962] [ENSMUST00000077871] [ENSMUST00000105262] [ENSMUST00000138410] [ENSMUST00000144825] [ENSMUST00000144959] [ENSMUST00000147356] [ENSMUST00000148954] [ENSMUST00000147454]
AlphaFold Q925T6
Predicted Effect probably benign
Transcript: ENSMUST00000041962
AA Change: S355F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042436
Gene: ENSMUSG00000034813
AA Change: S355F

DomainStartEndE-ValueType
PDZ 63 137 4.86e-13 SMART
PDZ 161 239 6.4e-22 SMART
PDZ 262 337 1.97e-13 SMART
low complexity region 354 367 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
low complexity region 413 424 N/A INTRINSIC
PDZ 429 509 6.36e-17 SMART
PDZ 530 606 1.11e-16 SMART
PDZ 629 703 1.73e-18 SMART
PDZ 947 1019 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077871
AA Change: S328F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077033
Gene: ENSMUSG00000034813
AA Change: S328F

DomainStartEndE-ValueType
PDZ 36 110 4.86e-13 SMART
PDZ 134 212 6.4e-22 SMART
PDZ 235 310 1.97e-13 SMART
low complexity region 327 340 N/A INTRINSIC
low complexity region 361 378 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
PDZ 402 482 6.36e-17 SMART
PDZ 503 579 1.11e-16 SMART
PDZ 602 676 1.73e-18 SMART
PDZ 920 992 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105262
AA Change: S354F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100897
Gene: ENSMUSG00000034813
AA Change: S354F

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 353 366 N/A INTRINSIC
low complexity region 387 404 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
PDZ 428 508 6.36e-17 SMART
PDZ 529 605 1.11e-16 SMART
PDZ 628 702 1.73e-18 SMART
PDZ 946 1018 2.79e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127787
Predicted Effect probably benign
Transcript: ENSMUST00000138410
AA Change: S406F

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123234
Gene: ENSMUSG00000034813
AA Change: S406F

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 1013 1085 2.79e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139352
Predicted Effect possibly damaging
Transcript: ENSMUST00000144825
AA Change: S327F

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121670
Gene: ENSMUSG00000034813
AA Change: S327F

DomainStartEndE-ValueType
PDZ 35 109 4.86e-13 SMART
PDZ 133 211 6.4e-22 SMART
PDZ 234 309 1.97e-13 SMART
low complexity region 326 339 N/A INTRINSIC
low complexity region 360 377 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
PDZ 401 481 6.36e-17 SMART
PDZ 502 578 1.11e-16 SMART
PDZ 601 675 1.73e-18 SMART
PDZ 919 991 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144959
AA Change: S406F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122323
Gene: ENSMUSG00000034813
AA Change: S406F

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 998 1070 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147356
AA Change: S407F

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000115478
Gene: ENSMUSG00000034813
AA Change: S407F

DomainStartEndE-ValueType
PDZ 63 137 4.86e-13 SMART
PDZ 161 239 6.4e-22 SMART
PDZ 262 337 1.97e-13 SMART
low complexity region 394 422 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
PDZ 481 561 6.36e-17 SMART
PDZ 582 658 1.11e-16 SMART
PDZ 681 755 1.73e-18 SMART
PDZ 999 1071 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148954
AA Change: S354F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118397
Gene: ENSMUSG00000034813
AA Change: S354F

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 353 366 N/A INTRINSIC
low complexity region 387 404 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
PDZ 428 508 6.36e-17 SMART
PDZ 529 605 1.11e-16 SMART
PDZ 628 702 1.73e-18 SMART
PDZ 961 1033 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147454
AA Change: S406F

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000118073
Gene: ENSMUSG00000034813
AA Change: S406F

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 998 1070 2.79e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147598
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein containing multiple PDZ (post synaptic density protein, Drosophila disc large tumor suppressor, and zonula occludens-1 protein) domains. The encoded protein acts as a mediator between cytoskeletal and membrane proteins, particularly in neuronal cells, and facilitates complex formation at the cell membrane. Mutation of this gene can cause embryonic lethality resulting from defects of the dermo-epidermal junction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous ablation of gene function results in embryonic lethality and blistering skin lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 119,888,683 (GRCm39) I1210F probably benign Het
Ankrd17 T C 5: 90,433,705 (GRCm39) H688R possibly damaging Het
Arhgap24 T A 5: 102,811,972 (GRCm39) N66K probably damaging Het
Atp1a1 C T 3: 101,497,782 (GRCm39) G335D probably damaging Het
Cacna1g C T 11: 94,350,381 (GRCm39) R488H possibly damaging Het
Cacna1h A T 17: 25,616,594 (GRCm39) V149E probably damaging Het
Cd22 G T 7: 30,572,595 (GRCm39) P338Q probably benign Het
Cntln G T 4: 85,015,076 (GRCm39) M1122I probably benign Het
Cntrl A G 2: 35,012,768 (GRCm39) N302S probably benign Het
Cog8 T C 8: 107,779,528 (GRCm39) R250G probably damaging Het
Cracdl A T 1: 37,665,093 (GRCm39) Y268* probably null Het
Creld2 T C 15: 88,707,956 (GRCm39) C232R probably damaging Het
Cyp2b23 G A 7: 26,372,574 (GRCm39) P347L probably damaging Het
Dnah5 T C 15: 28,403,688 (GRCm39) probably null Het
Eml6 C T 11: 29,974,459 (GRCm39) V40I probably damaging Het
Epb42 C T 2: 120,860,448 (GRCm39) probably null Het
Fcrla A G 1: 170,748,573 (GRCm39) L190P probably damaging Het
Galnt18 A T 7: 111,378,635 (GRCm39) Y40* probably null Het
Gdf7 A T 12: 8,348,073 (GRCm39) M416K probably damaging Het
Gm11232 T A 4: 71,675,156 (GRCm39) probably null Het
Gpam T A 19: 55,076,608 (GRCm39) N198Y probably damaging Het
Hey2 C T 10: 30,710,352 (GRCm39) A134T probably benign Het
Kat6a T C 8: 23,428,668 (GRCm39) I1341T probably benign Het
Kcnd3 T C 3: 105,575,502 (GRCm39) L542P probably benign Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lman2 T C 13: 55,499,064 (GRCm39) D234G probably benign Het
Map3k19 A C 1: 127,745,635 (GRCm39) I1273R probably damaging Het
Matn1 T A 4: 130,677,330 (GRCm39) F180I possibly damaging Het
Meikin T A 11: 54,261,767 (GRCm39) L61* probably null Het
Mroh2b G T 15: 4,955,166 (GRCm39) D720Y probably damaging Het
Myh13 T C 11: 67,221,872 (GRCm39) I199T probably damaging Het
Myh4 T A 11: 67,139,287 (GRCm39) S535T probably damaging Het
Myo5a T C 9: 75,120,347 (GRCm39) M1715T probably damaging Het
Nat8 A T 6: 85,807,971 (GRCm39) V54D probably damaging Het
Nbea A G 3: 55,992,748 (GRCm39) V286A probably damaging Het
Ndnf A G 6: 65,680,998 (GRCm39) K426E possibly damaging Het
Nup210l T A 3: 90,098,279 (GRCm39) N1410K possibly damaging Het
Oca2 A T 7: 55,971,269 (GRCm39) T399S probably damaging Het
Or10al2 A T 17: 37,983,816 (GRCm39) K301* probably null Het
Or1af1 A C 2: 37,109,671 (GRCm39) T57P possibly damaging Het
Or51a43 A T 7: 103,717,666 (GRCm39) C191S probably damaging Het
Or52h7 T A 7: 104,214,278 (GRCm39) N283K probably damaging Het
Or8c10 G A 9: 38,279,492 (GRCm39) V217I probably benign Het
Or8j3 A G 2: 86,028,596 (GRCm39) S167P probably damaging Het
Otogl A C 10: 107,714,013 (GRCm39) probably null Het
Pde4b C T 4: 102,462,373 (GRCm39) T511I probably damaging Het
Proser3 A G 7: 30,239,172 (GRCm39) probably null Het
Psmd12 G A 11: 107,370,472 (GRCm39) V24M probably damaging Het
Rbm17 A T 2: 11,598,272 (GRCm39) M170K probably benign Het
Rims2 C T 15: 39,374,710 (GRCm39) T1064I possibly damaging Het
Ripor3 C T 2: 167,834,573 (GRCm39) V281M probably damaging Het
Rreb1 C A 13: 38,130,904 (GRCm39) Q1353K possibly damaging Het
Sgo2a A G 1: 58,054,965 (GRCm39) D383G probably benign Het
Sik3 C T 9: 46,132,446 (GRCm39) T1346M probably damaging Het
Slx1b A T 7: 126,291,968 (GRCm39) V63E probably damaging Het
Son A G 16: 91,453,974 (GRCm39) D907G probably damaging Het
Src G A 2: 157,311,132 (GRCm39) V401M probably damaging Het
St3gal4 T C 9: 34,966,053 (GRCm39) K24E possibly damaging Het
Stat6 A G 10: 127,494,114 (GRCm39) K647R probably damaging Het
Tbl1xr1 G A 3: 22,247,333 (GRCm39) probably null Het
Tlk2 G A 11: 105,147,778 (GRCm39) probably null Het
Tmbim6 T A 15: 99,299,496 (GRCm39) I3K probably benign Het
Tmeff2 A T 1: 51,221,026 (GRCm39) I334F probably damaging Het
Ttn T C 2: 76,670,659 (GRCm39) probably null Het
Ubl7 T A 9: 57,821,894 (GRCm39) I81N probably damaging Het
Ugt1a10 A G 1: 87,983,433 (GRCm39) Y77C probably damaging Het
Uqcrfs1 A G 13: 30,724,890 (GRCm39) C217R probably damaging Het
Usp50 T C 2: 126,603,554 (GRCm39) T331A probably benign Het
Vmn1r65 A G 7: 6,012,156 (GRCm39) V26A probably benign Het
Wdfy3 A C 5: 102,065,445 (GRCm39) V1241G possibly damaging Het
Wtap A C 17: 13,200,631 (GRCm39) probably null Het
Zbtb40 C A 4: 136,712,148 (GRCm39) A1187S possibly damaging Het
Zfp57 T C 17: 37,316,990 (GRCm39) S20P probably damaging Het
Zfp592 A G 7: 80,674,227 (GRCm39) D397G probably damaging Het
Zfp747 A T 7: 126,973,676 (GRCm39) S165T probably benign Het
Zfp949 C T 9: 88,451,891 (GRCm39) T487I probably damaging Het
Zscan4d A G 7: 10,898,921 (GRCm39) C119R probably damaging Het
Other mutations in Grip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Grip1 APN 10 119,767,207 (GRCm39) nonsense probably null
IGL01374:Grip1 APN 10 119,885,273 (GRCm39) missense probably benign 0.03
IGL01592:Grip1 APN 10 119,765,908 (GRCm39) missense probably damaging 1.00
IGL02207:Grip1 APN 10 119,911,214 (GRCm39) missense probably damaging 1.00
IGL02222:Grip1 APN 10 119,835,714 (GRCm39) missense probably damaging 1.00
IGL02225:Grip1 APN 10 119,885,358 (GRCm39) missense probably damaging 1.00
IGL02447:Grip1 APN 10 119,855,976 (GRCm39) missense probably damaging 1.00
IGL02492:Grip1 APN 10 119,765,945 (GRCm39) splice site probably benign
IGL02522:Grip1 APN 10 119,767,154 (GRCm39) missense probably damaging 1.00
IGL02574:Grip1 APN 10 119,778,818 (GRCm39) missense probably damaging 1.00
IGL02718:Grip1 APN 10 119,911,420 (GRCm39) makesense probably null
IGL02751:Grip1 APN 10 119,814,482 (GRCm39) missense probably benign 0.08
IGL03221:Grip1 APN 10 119,822,299 (GRCm39) missense probably benign 0.00
IGL03377:Grip1 APN 10 119,890,937 (GRCm39) missense probably damaging 0.98
PIT4403001:Grip1 UTSW 10 119,765,833 (GRCm39) missense probably damaging 1.00
R0304:Grip1 UTSW 10 119,911,376 (GRCm39) missense probably benign 0.31
R0681:Grip1 UTSW 10 119,846,135 (GRCm39) missense probably damaging 1.00
R0760:Grip1 UTSW 10 119,853,983 (GRCm39) missense probably damaging 0.96
R1506:Grip1 UTSW 10 119,814,356 (GRCm39) missense probably damaging 1.00
R1541:Grip1 UTSW 10 119,836,448 (GRCm39) missense probably damaging 0.99
R1553:Grip1 UTSW 10 119,890,756 (GRCm39) missense probably damaging 1.00
R1709:Grip1 UTSW 10 119,733,620 (GRCm39) missense probably damaging 0.98
R2055:Grip1 UTSW 10 119,885,416 (GRCm39) splice site probably benign
R2059:Grip1 UTSW 10 119,874,603 (GRCm39) missense possibly damaging 0.80
R2261:Grip1 UTSW 10 119,821,489 (GRCm39) missense probably benign 0.00
R2475:Grip1 UTSW 10 119,814,401 (GRCm39) missense probably benign 0.01
R3777:Grip1 UTSW 10 119,821,535 (GRCm39) critical splice donor site probably null
R3849:Grip1 UTSW 10 119,765,863 (GRCm39) missense probably damaging 1.00
R3956:Grip1 UTSW 10 119,765,931 (GRCm39) missense probably damaging 1.00
R4643:Grip1 UTSW 10 119,856,006 (GRCm39) missense probably damaging 1.00
R4693:Grip1 UTSW 10 119,836,459 (GRCm39) missense probably benign 0.10
R4724:Grip1 UTSW 10 119,874,588 (GRCm39) missense probably benign 0.02
R4843:Grip1 UTSW 10 119,765,920 (GRCm39) missense probably damaging 1.00
R4884:Grip1 UTSW 10 119,911,211 (GRCm39) missense probably damaging 1.00
R4912:Grip1 UTSW 10 119,767,153 (GRCm39) missense probably damaging 1.00
R5185:Grip1 UTSW 10 119,767,164 (GRCm39) missense probably benign 0.37
R5291:Grip1 UTSW 10 119,922,874 (GRCm39) missense probably benign 0.04
R5293:Grip1 UTSW 10 119,733,640 (GRCm39) missense probably damaging 0.99
R5296:Grip1 UTSW 10 119,765,833 (GRCm39) missense probably damaging 1.00
R5302:Grip1 UTSW 10 119,855,982 (GRCm39) missense probably damaging 1.00
R5541:Grip1 UTSW 10 119,908,623 (GRCm39) missense probably damaging 1.00
R5792:Grip1 UTSW 10 119,821,385 (GRCm39) missense probably benign 0.07
R5861:Grip1 UTSW 10 119,765,875 (GRCm39) missense probably damaging 1.00
R5905:Grip1 UTSW 10 119,821,397 (GRCm39) missense probably benign 0.02
R5949:Grip1 UTSW 10 119,886,147 (GRCm39) missense probably benign 0.00
R6112:Grip1 UTSW 10 119,829,137 (GRCm39) missense probably benign 0.00
R6166:Grip1 UTSW 10 119,908,623 (GRCm39) missense probably damaging 1.00
R6167:Grip1 UTSW 10 119,733,702 (GRCm39) critical splice donor site probably null
R6193:Grip1 UTSW 10 119,874,219 (GRCm39) missense probably damaging 1.00
R6218:Grip1 UTSW 10 119,822,251 (GRCm39) missense possibly damaging 0.95
R6267:Grip1 UTSW 10 119,911,369 (GRCm39) nonsense probably null
R6296:Grip1 UTSW 10 119,911,369 (GRCm39) nonsense probably null
R6490:Grip1 UTSW 10 119,822,329 (GRCm39) missense possibly damaging 0.82
R6543:Grip1 UTSW 10 119,821,499 (GRCm39) missense probably benign 0.00
R6558:Grip1 UTSW 10 119,290,288 (GRCm39) missense probably benign 0.00
R6995:Grip1 UTSW 10 119,822,375 (GRCm39) missense probably damaging 0.99
R7122:Grip1 UTSW 10 119,871,279 (GRCm39) missense possibly damaging 0.48
R7157:Grip1 UTSW 10 119,781,061 (GRCm39) missense probably damaging 1.00
R7410:Grip1 UTSW 10 119,855,925 (GRCm39) missense probably benign 0.01
R7447:Grip1 UTSW 10 119,922,871 (GRCm39) missense probably benign 0.01
R7539:Grip1 UTSW 10 119,890,776 (GRCm39) missense probably benign 0.17
R7586:Grip1 UTSW 10 119,913,043 (GRCm39) splice site probably null
R7768:Grip1 UTSW 10 119,874,302 (GRCm39) missense probably damaging 0.98
R7831:Grip1 UTSW 10 119,854,011 (GRCm39) missense probably damaging 1.00
R7896:Grip1 UTSW 10 119,814,450 (GRCm39) missense possibly damaging 0.53
R8103:Grip1 UTSW 10 119,814,440 (GRCm39) missense probably benign 0.00
R8254:Grip1 UTSW 10 119,890,810 (GRCm39) nonsense probably null
R8688:Grip1 UTSW 10 119,835,809 (GRCm39) missense probably benign 0.12
R8823:Grip1 UTSW 10 119,811,856 (GRCm39) missense
R8837:Grip1 UTSW 10 119,765,940 (GRCm39) missense probably damaging 1.00
R8885:Grip1 UTSW 10 119,290,192 (GRCm39) start gained probably benign
R8951:Grip1 UTSW 10 119,874,509 (GRCm39) missense possibly damaging 0.85
R9042:Grip1 UTSW 10 119,836,438 (GRCm39) missense probably benign 0.14
R9045:Grip1 UTSW 10 119,871,356 (GRCm39) missense probably damaging 0.97
R9237:Grip1 UTSW 10 119,911,310 (GRCm39) missense probably benign 0.07
R9254:Grip1 UTSW 10 119,780,961 (GRCm39) missense probably damaging 1.00
R9259:Grip1 UTSW 10 119,874,569 (GRCm39) missense possibly damaging 0.63
R9260:Grip1 UTSW 10 119,874,569 (GRCm39) missense possibly damaging 0.63
R9307:Grip1 UTSW 10 119,821,454 (GRCm39) missense probably benign 0.01
R9379:Grip1 UTSW 10 119,780,961 (GRCm39) missense probably damaging 1.00
R9546:Grip1 UTSW 10 119,874,569 (GRCm39) missense possibly damaging 0.63
R9547:Grip1 UTSW 10 119,874,569 (GRCm39) missense possibly damaging 0.63
R9548:Grip1 UTSW 10 119,874,569 (GRCm39) missense possibly damaging 0.63
R9549:Grip1 UTSW 10 119,874,569 (GRCm39) missense possibly damaging 0.63
R9583:Grip1 UTSW 10 119,874,569 (GRCm39) missense possibly damaging 0.63
R9584:Grip1 UTSW 10 119,874,569 (GRCm39) missense possibly damaging 0.63
R9610:Grip1 UTSW 10 119,874,569 (GRCm39) missense possibly damaging 0.63
R9611:Grip1 UTSW 10 119,874,569 (GRCm39) missense possibly damaging 0.63
R9612:Grip1 UTSW 10 119,874,569 (GRCm39) missense possibly damaging 0.63
R9684:Grip1 UTSW 10 119,874,569 (GRCm39) missense possibly damaging 0.63
R9687:Grip1 UTSW 10 119,874,569 (GRCm39) missense possibly damaging 0.63
R9690:Grip1 UTSW 10 119,874,569 (GRCm39) missense possibly damaging 0.63
R9691:Grip1 UTSW 10 119,874,569 (GRCm39) missense possibly damaging 0.63
R9742:Grip1 UTSW 10 119,874,569 (GRCm39) missense possibly damaging 0.63
R9744:Grip1 UTSW 10 119,874,569 (GRCm39) missense possibly damaging 0.63
R9752:Grip1 UTSW 10 119,871,256 (GRCm39) missense possibly damaging 0.46
R9758:Grip1 UTSW 10 119,874,569 (GRCm39) missense possibly damaging 0.63
R9762:Grip1 UTSW 10 119,811,906 (GRCm39) missense possibly damaging 0.92
R9764:Grip1 UTSW 10 119,874,569 (GRCm39) missense possibly damaging 0.63
RF011:Grip1 UTSW 10 119,767,220 (GRCm39) missense probably null 0.97
Z1176:Grip1 UTSW 10 119,655,388 (GRCm39) unclassified probably benign
Z1177:Grip1 UTSW 10 119,822,349 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCAGGGGACACCTCAGAACATTGG -3'
(R):5'- ACACAGCAACTGTCAGATTACCGTC -3'

Sequencing Primer
(F):5'- AAATGACACTGTGTGCCTGATG -3'
(R):5'- GCATCTTCTGGAGACCAAATG -3'
Posted On 2014-03-14