Mutagenetix > Incidental Mutation

Incidental Mutation 'R1457:Stat6'

158589

Institutional Source

Beutler Lab

Gene Symbol

Stat6

Ensembl Gene

ENSMUSG00000002147

Gene Name

signal transducer and activator of transcription 6

Synonyms

MMRRC Submission

039512-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.758) question?

Stock #

R1457 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

127642986-127660957 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 127658245 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 647 (K647R)

Ref Sequence

ENSEMBL: ENSMUSP00000089708 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026469] [ENSMUST00000092074] [ENSMUST00000099157]

AlphaFold

P52633

Predicted Effect

probably benign
Transcript: ENSMUST00000026469

SMART Domains

Protein: ENSMUSP00000026469
Gene: ENSMUSG00000025402

Domain	Start	End	E-Value	Type
Pfam:NCD1	36	114	1.2e-44	PFAM
Pfam:NCD2	230	364	3.2e-59	PFAM
low complexity region	393	406	N/A	INTRINSIC
low complexity region	431	446	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000092074
AA Change: K647R

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000089708
Gene: ENSMUSG00000002147
AA Change: K647R

Domain	Start	End	E-Value	Type
STAT_int	2	116	2.76e-31	SMART
Pfam:STAT_bind	273	526	4.4e-87	PFAM
SH2	540	622	1.33e-5	SMART
Pfam:STAT6_C	655	837	1.1e-94	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000099157

SMART Domains

Protein: ENSMUSP00000096761
Gene: ENSMUSG00000025402

Domain	Start	End	E-Value	Type
Pfam:NCD1	34	115	4.4e-51	PFAM
Pfam:NCD2	199	366	3.6e-74	PFAM
low complexity region	393	406	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128072

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145470

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156231

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.7%
20x: 87.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein plays a central role in exerting IL4 mediated biological responses. It is found to induce the expression of BCL2L1/BCL-X(L), which is responsible for the anti-apoptotic activity of IL4. Knockout studies in mice suggested the roles of this gene in differentiation of T helper 2 (Th2) cells, expression of cell surface markers, and class switch of immunoglobulins. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired IL4 responses, including anti-IgM stimulated B cell proliferation, class switching to IgE, contact sensitivity, and Th2 cytokine production, and show increased resistance to certain infections. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	A	T	1: 37,626,012	Y268*	probably null	Het
Abca14	A	T	7: 120,289,460	I1210F	probably benign	Het
Ankrd17	T	C	5: 90,285,846	H688R	possibly damaging	Het
Arhgap24	T	A	5: 102,664,106	N66K	probably damaging	Het
Atp1a1	C	T	3: 101,590,466	G335D	probably damaging	Het
Cacna1g	C	T	11: 94,459,555	R488H	possibly damaging	Het
Cacna1h	A	T	17: 25,397,620	V149E	probably damaging	Het
Cd22	G	T	7: 30,873,170	P338Q	probably benign	Het
Cntln	G	T	4: 85,096,839	M1122I	probably benign	Het
Cntrl	A	G	2: 35,122,756	N302S	probably benign	Het
Cog8	T	C	8: 107,052,896	R250G	probably damaging	Het
Creld2	T	C	15: 88,823,753	C232R	probably damaging	Het
Cyp2b23	G	A	7: 26,673,149	P347L	probably damaging	Het
Dnah5	T	C	15: 28,403,542		probably null	Het
Eml6	C	T	11: 30,024,459	V40I	probably damaging	Het
Epb42	C	T	2: 121,029,967		probably null	Het
Fcrla	A	G	1: 170,921,004	L190P	probably damaging	Het
Galnt18	A	T	7: 111,779,428	Y40*	probably null	Het
Gdf7	A	T	12: 8,298,073	M416K	probably damaging	Het
Gm11232	T	A	4: 71,756,919		probably null	Het
Gpam	T	A	19: 55,088,176	N198Y	probably damaging	Het
Grip1	C	T	10: 119,986,350	S327F	possibly damaging	Het
Hey2	C	T	10: 30,834,356	A134T	probably benign	Het
Kat6a	T	C	8: 22,938,652	I1341T	probably benign	Het
Kcnd3	T	C	3: 105,668,186	L542P	probably benign	Het
Lars	G	A	18: 42,210,050	R1101C	probably damaging	Het
Lman2	T	C	13: 55,351,251	D234G	probably benign	Het
Map3k19	A	C	1: 127,817,898	I1273R	probably damaging	Het
Matn1	T	A	4: 130,950,019	F180I	possibly damaging	Het
Meikin	T	A	11: 54,370,941	L61*	probably null	Het
Mroh2b	G	T	15: 4,925,684	D720Y	probably damaging	Het
Myh13	T	C	11: 67,331,046	I199T	probably damaging	Het
Myh4	T	A	11: 67,248,461	S535T	probably damaging	Het
Myo5a	T	C	9: 75,213,065	M1715T	probably damaging	Het
Nat8	A	T	6: 85,830,989	V54D	probably damaging	Het
Nbea	A	G	3: 56,085,327	V286A	probably damaging	Het
Ndnf	A	G	6: 65,704,014	K426E	possibly damaging	Het
Nup210l	T	A	3: 90,190,972	N1410K	possibly damaging	Het
Oca2	A	T	7: 56,321,521	T399S	probably damaging	Het
Olfr1045	A	G	2: 86,198,252	S167P	probably damaging	Het
Olfr118	A	T	17: 37,672,925	K301*	probably null	Het
Olfr250	G	A	9: 38,368,196	V217I	probably benign	Het
Olfr366	A	C	2: 37,219,659	T57P	possibly damaging	Het
Olfr644	A	T	7: 104,068,459	C191S	probably damaging	Het
Olfr652	T	A	7: 104,565,071	N283K	probably damaging	Het
Otogl	A	C	10: 107,878,152		probably null	Het
Pde4b	C	T	4: 102,605,176	T511I	probably damaging	Het
Proser3	A	G	7: 30,539,747		probably null	Het
Psmd12	G	A	11: 107,479,646	V24M	probably damaging	Het
Rbm17	A	T	2: 11,593,461	M170K	probably benign	Het
Rims2	C	T	15: 39,511,314	T1064I	possibly damaging	Het
Ripor3	C	T	2: 167,992,653	V281M	probably damaging	Het
Rreb1	C	A	13: 37,946,928	Q1353K	possibly damaging	Het
Sgo2a	A	G	1: 58,015,806	D383G	probably benign	Het
Sik3	C	T	9: 46,221,148	T1346M	probably damaging	Het
Slx1b	A	T	7: 126,692,796	V63E	probably damaging	Het
Son	A	G	16: 91,657,086	D907G	probably damaging	Het
Src	G	A	2: 157,469,212	V401M	probably damaging	Het
St3gal4	T	C	9: 35,054,757	K24E	possibly damaging	Het
Tbl1xr1	G	A	3: 22,193,169		probably null	Het
Tlk2	G	A	11: 105,256,952		probably null	Het
Tmbim6	T	A	15: 99,401,615	I3K	probably benign	Het
Tmeff2	A	T	1: 51,181,867	I334F	probably damaging	Het
Ttn	T	C	2: 76,840,315		probably null	Het
Ubl7	T	A	9: 57,914,611	I81N	probably damaging	Het
Ugt1a10	A	G	1: 88,055,711	Y77C	probably damaging	Het
Uqcrfs1	A	G	13: 30,540,907	C217R	probably damaging	Het
Usp50	T	C	2: 126,761,634	T331A	probably benign	Het
Vmn1r65	A	G	7: 6,009,157	V26A	probably benign	Het
Wdfy3	A	C	5: 101,917,579	V1241G	possibly damaging	Het
Wtap	A	C	17: 12,981,744		probably null	Het
Zbtb40	C	A	4: 136,984,837	A1187S	possibly damaging	Het
Zfp57	T	C	17: 37,006,098	S20P	probably damaging	Het
Zfp592	A	G	7: 81,024,479	D397G	probably damaging	Het
Zfp747	A	T	7: 127,374,504	S165T	probably benign	Het
Zfp949	C	T	9: 88,569,838	T487I	probably damaging	Het
Zscan4d	A	G	7: 11,164,994	C119R	probably damaging	Het

Other mutations in Stat6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01097:Stat6	APN	10	127654932	missense	probably damaging	1.00
IGL01785:Stat6	APN	10	127657227	missense	probably damaging	1.00
IGL02939:Stat6	APN	10	127646940	missense	probably benign	0.05
IGL03266:Stat6	APN	10	127657155	missense	possibly damaging	0.88
IGL03412:Stat6	APN	10	127658205	missense	probably benign	0.00
Rigid	UTSW	10	127658702	critical splice donor site	probably null
Stationary	UTSW	10	127652222	missense	possibly damaging	0.93
PIT4142001:Stat6	UTSW	10	127658230	missense	possibly damaging	0.95
R0165:Stat6	UTSW	10	127657227	missense	probably damaging	0.98
R0581:Stat6	UTSW	10	127648116	missense	probably damaging	0.99
R0735:Stat6	UTSW	10	127658241	missense	probably damaging	1.00
R1333:Stat6	UTSW	10	127651225	missense	possibly damaging	0.62
R1352:Stat6	UTSW	10	127650811	missense	probably benign	0.32
R1538:Stat6	UTSW	10	127653256	missense	probably damaging	1.00
R1696:Stat6	UTSW	10	127653049	missense	probably damaging	1.00
R2016:Stat6	UTSW	10	127650796	missense	probably damaging	1.00
R3236:Stat6	UTSW	10	127652222	missense	possibly damaging	0.93
R3980:Stat6	UTSW	10	127655379	missense	probably damaging	1.00
R4467:Stat6	UTSW	10	127651228	missense	probably damaging	1.00
R5346:Stat6	UTSW	10	127652313	missense	probably benign	0.44
R5481:Stat6	UTSW	10	127647826	splice site	probably null
R5722:Stat6	UTSW	10	127658373	missense	probably benign	0.00
R6036:Stat6	UTSW	10	127655444	missense	possibly damaging	0.58
R6036:Stat6	UTSW	10	127655444	missense	possibly damaging	0.58
R6244:Stat6	UTSW	10	127657712	splice site	probably null
R6914:Stat6	UTSW	10	127651262	missense	probably damaging	1.00
R6937:Stat6	UTSW	10	127658702	critical splice donor site	probably null
R6942:Stat6	UTSW	10	127651262	missense	probably damaging	1.00
R8231:Stat6	UTSW	10	127646973	missense	possibly damaging	0.61
R8995:Stat6	UTSW	10	127658642	missense	probably benign	0.00
R9162:Stat6	UTSW	10	127651220	missense	probably damaging	0.99
R9192:Stat6	UTSW	10	127657610	missense	probably damaging	1.00
R9252:Stat6	UTSW	10	127647792	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CTGAAACCTCCTGTCACACACTGTC -3'
(R):5'- TGAGCTGAGTTGCATGGAAGCATC -3'

Sequencing Primer
(F):5'- cttcttccctccctctttcac -3'
(R):5'- AAGCATCAGGGGCCATTC -3'

Posted On

2014-03-14