Incidental Mutation 'R1457:Eml6'
ID 158590
Institutional Source Beutler Lab
Gene Symbol Eml6
Ensembl Gene ENSMUSG00000044072
Gene Name echinoderm microtubule associated protein like 6
Synonyms 2900083P10Rik, C230094A16Rik
MMRRC Submission 039512-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.228) question?
Stock # R1457 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 29693048-29976033 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 29974459 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 40 (V40I)
Ref Sequence ENSEMBL: ENSMUSP00000051080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902]
AlphaFold Q5SQM0
Predicted Effect probably damaging
Transcript: ENSMUST00000058902
AA Change: V40I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072
AA Change: V40I

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 119,888,683 (GRCm39) I1210F probably benign Het
Ankrd17 T C 5: 90,433,705 (GRCm39) H688R possibly damaging Het
Arhgap24 T A 5: 102,811,972 (GRCm39) N66K probably damaging Het
Atp1a1 C T 3: 101,497,782 (GRCm39) G335D probably damaging Het
Cacna1g C T 11: 94,350,381 (GRCm39) R488H possibly damaging Het
Cacna1h A T 17: 25,616,594 (GRCm39) V149E probably damaging Het
Cd22 G T 7: 30,572,595 (GRCm39) P338Q probably benign Het
Cntln G T 4: 85,015,076 (GRCm39) M1122I probably benign Het
Cntrl A G 2: 35,012,768 (GRCm39) N302S probably benign Het
Cog8 T C 8: 107,779,528 (GRCm39) R250G probably damaging Het
Cracdl A T 1: 37,665,093 (GRCm39) Y268* probably null Het
Creld2 T C 15: 88,707,956 (GRCm39) C232R probably damaging Het
Cyp2b23 G A 7: 26,372,574 (GRCm39) P347L probably damaging Het
Dnah5 T C 15: 28,403,688 (GRCm39) probably null Het
Epb42 C T 2: 120,860,448 (GRCm39) probably null Het
Fcrla A G 1: 170,748,573 (GRCm39) L190P probably damaging Het
Galnt18 A T 7: 111,378,635 (GRCm39) Y40* probably null Het
Gdf7 A T 12: 8,348,073 (GRCm39) M416K probably damaging Het
Gm11232 T A 4: 71,675,156 (GRCm39) probably null Het
Gpam T A 19: 55,076,608 (GRCm39) N198Y probably damaging Het
Grip1 C T 10: 119,822,255 (GRCm39) S327F possibly damaging Het
Hey2 C T 10: 30,710,352 (GRCm39) A134T probably benign Het
Kat6a T C 8: 23,428,668 (GRCm39) I1341T probably benign Het
Kcnd3 T C 3: 105,575,502 (GRCm39) L542P probably benign Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lman2 T C 13: 55,499,064 (GRCm39) D234G probably benign Het
Map3k19 A C 1: 127,745,635 (GRCm39) I1273R probably damaging Het
Matn1 T A 4: 130,677,330 (GRCm39) F180I possibly damaging Het
Meikin T A 11: 54,261,767 (GRCm39) L61* probably null Het
Mroh2b G T 15: 4,955,166 (GRCm39) D720Y probably damaging Het
Myh13 T C 11: 67,221,872 (GRCm39) I199T probably damaging Het
Myh4 T A 11: 67,139,287 (GRCm39) S535T probably damaging Het
Myo5a T C 9: 75,120,347 (GRCm39) M1715T probably damaging Het
Nat8 A T 6: 85,807,971 (GRCm39) V54D probably damaging Het
Nbea A G 3: 55,992,748 (GRCm39) V286A probably damaging Het
Ndnf A G 6: 65,680,998 (GRCm39) K426E possibly damaging Het
Nup210l T A 3: 90,098,279 (GRCm39) N1410K possibly damaging Het
Oca2 A T 7: 55,971,269 (GRCm39) T399S probably damaging Het
Or10al2 A T 17: 37,983,816 (GRCm39) K301* probably null Het
Or1af1 A C 2: 37,109,671 (GRCm39) T57P possibly damaging Het
Or51a43 A T 7: 103,717,666 (GRCm39) C191S probably damaging Het
Or52h7 T A 7: 104,214,278 (GRCm39) N283K probably damaging Het
Or8c10 G A 9: 38,279,492 (GRCm39) V217I probably benign Het
Or8j3 A G 2: 86,028,596 (GRCm39) S167P probably damaging Het
Otogl A C 10: 107,714,013 (GRCm39) probably null Het
Pde4b C T 4: 102,462,373 (GRCm39) T511I probably damaging Het
Proser3 A G 7: 30,239,172 (GRCm39) probably null Het
Psmd12 G A 11: 107,370,472 (GRCm39) V24M probably damaging Het
Rbm17 A T 2: 11,598,272 (GRCm39) M170K probably benign Het
Rims2 C T 15: 39,374,710 (GRCm39) T1064I possibly damaging Het
Ripor3 C T 2: 167,834,573 (GRCm39) V281M probably damaging Het
Rreb1 C A 13: 38,130,904 (GRCm39) Q1353K possibly damaging Het
Sgo2a A G 1: 58,054,965 (GRCm39) D383G probably benign Het
Sik3 C T 9: 46,132,446 (GRCm39) T1346M probably damaging Het
Slx1b A T 7: 126,291,968 (GRCm39) V63E probably damaging Het
Son A G 16: 91,453,974 (GRCm39) D907G probably damaging Het
Src G A 2: 157,311,132 (GRCm39) V401M probably damaging Het
St3gal4 T C 9: 34,966,053 (GRCm39) K24E possibly damaging Het
Stat6 A G 10: 127,494,114 (GRCm39) K647R probably damaging Het
Tbl1xr1 G A 3: 22,247,333 (GRCm39) probably null Het
Tlk2 G A 11: 105,147,778 (GRCm39) probably null Het
Tmbim6 T A 15: 99,299,496 (GRCm39) I3K probably benign Het
Tmeff2 A T 1: 51,221,026 (GRCm39) I334F probably damaging Het
Ttn T C 2: 76,670,659 (GRCm39) probably null Het
Ubl7 T A 9: 57,821,894 (GRCm39) I81N probably damaging Het
Ugt1a10 A G 1: 87,983,433 (GRCm39) Y77C probably damaging Het
Uqcrfs1 A G 13: 30,724,890 (GRCm39) C217R probably damaging Het
Usp50 T C 2: 126,603,554 (GRCm39) T331A probably benign Het
Vmn1r65 A G 7: 6,012,156 (GRCm39) V26A probably benign Het
Wdfy3 A C 5: 102,065,445 (GRCm39) V1241G possibly damaging Het
Wtap A C 17: 13,200,631 (GRCm39) probably null Het
Zbtb40 C A 4: 136,712,148 (GRCm39) A1187S possibly damaging Het
Zfp57 T C 17: 37,316,990 (GRCm39) S20P probably damaging Het
Zfp592 A G 7: 80,674,227 (GRCm39) D397G probably damaging Het
Zfp747 A T 7: 126,973,676 (GRCm39) S165T probably benign Het
Zfp949 C T 9: 88,451,891 (GRCm39) T487I probably damaging Het
Zscan4d A G 7: 10,898,921 (GRCm39) C119R probably damaging Het
Other mutations in Eml6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Eml6 APN 11 29,800,816 (GRCm39) critical splice donor site probably null
IGL01407:Eml6 APN 11 29,705,021 (GRCm39) nonsense probably null
IGL01434:Eml6 APN 11 29,769,090 (GRCm39) missense probably damaging 1.00
IGL01578:Eml6 APN 11 29,800,870 (GRCm39) missense probably benign 0.02
IGL01780:Eml6 APN 11 29,755,175 (GRCm39) missense probably benign 0.17
IGL01821:Eml6 APN 11 29,771,699 (GRCm39) missense probably benign 0.00
IGL01837:Eml6 APN 11 29,727,055 (GRCm39) missense probably benign 0.00
IGL01904:Eml6 APN 11 29,788,613 (GRCm39) nonsense probably null
IGL01972:Eml6 APN 11 29,788,451 (GRCm39) missense possibly damaging 0.67
IGL02134:Eml6 APN 11 29,709,066 (GRCm39) missense probably benign 0.13
IGL02192:Eml6 APN 11 29,755,743 (GRCm39) missense probably benign 0.00
IGL02377:Eml6 APN 11 29,727,282 (GRCm39) missense probably damaging 0.98
IGL02584:Eml6 APN 11 29,699,387 (GRCm39) missense probably damaging 0.99
IGL02587:Eml6 APN 11 29,734,236 (GRCm39) missense possibly damaging 0.92
IGL02810:Eml6 APN 11 29,799,016 (GRCm39) missense possibly damaging 0.94
IGL02873:Eml6 APN 11 29,830,700 (GRCm39) missense probably benign 0.10
IGL02880:Eml6 APN 11 29,699,959 (GRCm39) missense probably benign 0.03
IGL03289:Eml6 APN 11 29,745,328 (GRCm39) missense possibly damaging 0.49
IGL03301:Eml6 APN 11 29,714,083 (GRCm39) missense probably benign 0.18
IGL03386:Eml6 APN 11 29,699,934 (GRCm39) missense probably benign
IGL03407:Eml6 APN 11 29,856,330 (GRCm39) missense probably damaging 1.00
PIT4453001:Eml6 UTSW 11 29,752,489 (GRCm39) missense probably damaging 1.00
R0125:Eml6 UTSW 11 29,832,088 (GRCm39) missense probably benign 0.19
R0240:Eml6 UTSW 11 29,742,367 (GRCm39) missense possibly damaging 0.84
R0240:Eml6 UTSW 11 29,742,367 (GRCm39) missense possibly damaging 0.84
R0271:Eml6 UTSW 11 29,798,949 (GRCm39) missense possibly damaging 0.48
R0304:Eml6 UTSW 11 29,727,441 (GRCm39) missense probably benign 0.00
R0415:Eml6 UTSW 11 29,699,392 (GRCm39) missense possibly damaging 0.84
R0449:Eml6 UTSW 11 29,843,213 (GRCm39) missense probably benign 0.01
R0538:Eml6 UTSW 11 29,710,010 (GRCm39) splice site probably benign
R0671:Eml6 UTSW 11 29,755,065 (GRCm39) missense probably benign 0.00
R0766:Eml6 UTSW 11 29,781,219 (GRCm39) splice site probably benign
R0800:Eml6 UTSW 11 29,699,877 (GRCm39) missense probably benign 0.08
R0841:Eml6 UTSW 11 29,727,430 (GRCm39) missense probably benign 0.41
R0879:Eml6 UTSW 11 29,800,816 (GRCm39) critical splice donor site probably null
R1061:Eml6 UTSW 11 29,727,267 (GRCm39) missense probably damaging 1.00
R1145:Eml6 UTSW 11 29,727,430 (GRCm39) missense probably benign 0.41
R1145:Eml6 UTSW 11 29,727,430 (GRCm39) missense probably benign 0.41
R1172:Eml6 UTSW 11 29,699,824 (GRCm39) missense possibly damaging 0.54
R1173:Eml6 UTSW 11 29,699,824 (GRCm39) missense possibly damaging 0.54
R1174:Eml6 UTSW 11 29,699,824 (GRCm39) missense possibly damaging 0.54
R1199:Eml6 UTSW 11 29,705,044 (GRCm39) missense possibly damaging 0.93
R1311:Eml6 UTSW 11 29,781,088 (GRCm39) splice site probably benign
R1312:Eml6 UTSW 11 29,781,219 (GRCm39) splice site probably benign
R1355:Eml6 UTSW 11 29,783,085 (GRCm39) missense probably benign 0.03
R1370:Eml6 UTSW 11 29,783,085 (GRCm39) missense probably benign 0.03
R1486:Eml6 UTSW 11 29,755,114 (GRCm39) missense possibly damaging 0.83
R1511:Eml6 UTSW 11 29,768,374 (GRCm39) missense probably damaging 1.00
R1532:Eml6 UTSW 11 29,742,256 (GRCm39) splice site probably null
R1642:Eml6 UTSW 11 29,727,001 (GRCm39) critical splice donor site probably null
R1682:Eml6 UTSW 11 29,709,065 (GRCm39) missense probably benign 0.13
R1687:Eml6 UTSW 11 29,783,187 (GRCm39) missense probably damaging 1.00
R1699:Eml6 UTSW 11 29,696,282 (GRCm39) nonsense probably null
R1796:Eml6 UTSW 11 29,831,975 (GRCm39) missense probably benign 0.19
R1797:Eml6 UTSW 11 29,832,041 (GRCm39) missense probably benign 0.09
R1837:Eml6 UTSW 11 29,699,802 (GRCm39) splice site probably null
R1874:Eml6 UTSW 11 29,781,136 (GRCm39) missense probably damaging 0.99
R1967:Eml6 UTSW 11 29,974,545 (GRCm39) missense probably damaging 1.00
R1969:Eml6 UTSW 11 29,783,075 (GRCm39) missense probably benign
R2007:Eml6 UTSW 11 29,798,814 (GRCm39) critical splice donor site probably null
R2012:Eml6 UTSW 11 29,781,128 (GRCm39) missense possibly damaging 0.85
R2198:Eml6 UTSW 11 29,800,935 (GRCm39) missense probably benign 0.01
R2217:Eml6 UTSW 11 29,768,907 (GRCm39) missense probably damaging 1.00
R2218:Eml6 UTSW 11 29,768,907 (GRCm39) missense probably damaging 1.00
R2403:Eml6 UTSW 11 29,752,434 (GRCm39) missense probably benign 0.05
R2520:Eml6 UTSW 11 29,741,993 (GRCm39) missense probably damaging 1.00
R2937:Eml6 UTSW 11 29,783,049 (GRCm39) splice site probably benign
R2938:Eml6 UTSW 11 29,783,049 (GRCm39) splice site probably benign
R3085:Eml6 UTSW 11 29,759,332 (GRCm39) missense probably damaging 0.96
R3236:Eml6 UTSW 11 29,781,097 (GRCm39) critical splice donor site probably null
R3738:Eml6 UTSW 11 29,753,137 (GRCm39) missense probably benign 0.20
R3739:Eml6 UTSW 11 29,753,137 (GRCm39) missense probably benign 0.20
R3752:Eml6 UTSW 11 29,759,360 (GRCm39) missense probably benign 0.06
R3854:Eml6 UTSW 11 29,699,905 (GRCm39) missense possibly damaging 0.76
R3941:Eml6 UTSW 11 29,753,167 (GRCm39) missense probably damaging 0.98
R4034:Eml6 UTSW 11 29,753,137 (GRCm39) missense probably benign 0.20
R4049:Eml6 UTSW 11 29,788,577 (GRCm39) missense probably damaging 1.00
R4108:Eml6 UTSW 11 29,755,136 (GRCm39) missense probably damaging 0.98
R4657:Eml6 UTSW 11 29,755,108 (GRCm39) missense possibly damaging 0.77
R4662:Eml6 UTSW 11 29,727,390 (GRCm39) missense probably damaging 1.00
R4665:Eml6 UTSW 11 29,769,007 (GRCm39) nonsense probably null
R4721:Eml6 UTSW 11 29,788,525 (GRCm39) missense possibly damaging 0.95
R4729:Eml6 UTSW 11 29,783,204 (GRCm39) missense probably damaging 1.00
R4766:Eml6 UTSW 11 29,755,757 (GRCm39) missense probably benign 0.22
R4810:Eml6 UTSW 11 29,705,011 (GRCm39) missense possibly damaging 0.92
R4831:Eml6 UTSW 11 29,727,052 (GRCm39) nonsense probably null
R5035:Eml6 UTSW 11 29,804,187 (GRCm39) missense probably benign 0.00
R5064:Eml6 UTSW 11 29,699,300 (GRCm39) missense probably benign 0.12
R5103:Eml6 UTSW 11 29,800,905 (GRCm39) missense possibly damaging 0.65
R5121:Eml6 UTSW 11 29,694,606 (GRCm39) missense probably benign 0.03
R5161:Eml6 UTSW 11 29,974,467 (GRCm39) missense probably damaging 0.99
R5211:Eml6 UTSW 11 29,804,145 (GRCm39) missense probably benign 0.02
R5268:Eml6 UTSW 11 29,753,108 (GRCm39) missense probably benign 0.15
R5390:Eml6 UTSW 11 29,710,096 (GRCm39) missense probably damaging 1.00
R5529:Eml6 UTSW 11 29,714,126 (GRCm39) missense probably benign 0.04
R6239:Eml6 UTSW 11 29,699,275 (GRCm39) missense probably damaging 1.00
R6326:Eml6 UTSW 11 29,769,066 (GRCm39) missense probably damaging 1.00
R6395:Eml6 UTSW 11 29,759,321 (GRCm39) missense probably benign 0.00
R6476:Eml6 UTSW 11 29,741,971 (GRCm39) critical splice donor site probably null
R6483:Eml6 UTSW 11 29,699,875 (GRCm39) missense probably benign 0.00
R6701:Eml6 UTSW 11 29,735,748 (GRCm39) missense probably damaging 0.98
R6753:Eml6 UTSW 11 29,704,987 (GRCm39) missense probably damaging 1.00
R6809:Eml6 UTSW 11 29,753,161 (GRCm39) missense probably benign 0.23
R6847:Eml6 UTSW 11 29,768,447 (GRCm39) missense probably benign 0.00
R6855:Eml6 UTSW 11 29,701,381 (GRCm39) splice site probably null
R7168:Eml6 UTSW 11 29,788,529 (GRCm39) missense probably benign 0.01
R7175:Eml6 UTSW 11 29,734,231 (GRCm39) missense probably benign 0.00
R7305:Eml6 UTSW 11 29,727,258 (GRCm39) missense probably benign 0.01
R7615:Eml6 UTSW 11 29,752,501 (GRCm39) missense possibly damaging 0.49
R7692:Eml6 UTSW 11 29,703,085 (GRCm39) missense probably damaging 0.98
R7980:Eml6 UTSW 11 29,783,205 (GRCm39) missense probably damaging 1.00
R8026:Eml6 UTSW 11 29,699,973 (GRCm39) missense possibly damaging 0.63
R8046:Eml6 UTSW 11 29,708,981 (GRCm39) missense probably damaging 0.99
R8049:Eml6 UTSW 11 29,843,201 (GRCm39) missense possibly damaging 0.95
R8114:Eml6 UTSW 11 29,704,910 (GRCm39) missense probably damaging 1.00
R8425:Eml6 UTSW 11 29,705,008 (GRCm39) missense probably benign 0.00
R8799:Eml6 UTSW 11 29,708,981 (GRCm39) missense probably benign 0.11
R8945:Eml6 UTSW 11 29,703,110 (GRCm39) missense probably damaging 0.98
R8977:Eml6 UTSW 11 29,734,182 (GRCm39) missense possibly damaging 0.59
R8986:Eml6 UTSW 11 29,755,181 (GRCm39) missense possibly damaging 0.92
R9088:Eml6 UTSW 11 29,768,424 (GRCm39) missense probably damaging 0.96
R9150:Eml6 UTSW 11 29,755,791 (GRCm39) missense probably benign 0.15
R9209:Eml6 UTSW 11 29,781,175 (GRCm39) missense probably damaging 1.00
R9288:Eml6 UTSW 11 29,788,641 (GRCm39) critical splice acceptor site probably null
R9467:Eml6 UTSW 11 29,769,076 (GRCm39) missense probably damaging 0.99
R9481:Eml6 UTSW 11 29,788,641 (GRCm39) critical splice acceptor site probably null
R9534:Eml6 UTSW 11 29,734,155 (GRCm39) missense possibly damaging 0.45
RF037:Eml6 UTSW 11 29,702,549 (GRCm39) critical splice acceptor site probably benign
RF039:Eml6 UTSW 11 29,702,551 (GRCm39) critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- TGTTGAAGAACCTACTGAGGAGCCC -3'
(R):5'- TCGAGCCTTGAAGAGGACAGAGTC -3'

Sequencing Primer
(F):5'- TCCTTCCACTTGTAGCAGGAAAG -3'
(R):5'- GACAGAGTCGGCGCTCG -3'
Posted On 2014-03-14