Incidental Mutation 'R1457:Rreb1'
ID158601
Institutional Source Beutler Lab
Gene Symbol Rreb1
Ensembl Gene ENSMUSG00000039087
Gene Nameras responsive element binding protein 1
Synonyms1110037N09Rik, B930013M22Rik
MMRRC Submission 039512-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R1457 (G1)
Quality Score133
Status Not validated
Chromosome13
Chromosomal Location37778400-37952005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 37946928 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1353 (Q1353K)
Ref Sequence ENSEMBL: ENSMUSP00000115599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037232] [ENSMUST00000124373] [ENSMUST00000128570]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037232
AA Change: Q1353K

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049265
Gene: ENSMUSG00000039087
AA Change: Q1353K

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
ZnF_C2H2 1279 1302 1.01e-1 SMART
low complexity region 1324 1339 N/A INTRINSIC
low complexity region 1370 1403 N/A INTRINSIC
ZnF_C2H2 1454 1476 6.13e-1 SMART
low complexity region 1501 1516 N/A INTRINSIC
low complexity region 1535 1548 N/A INTRINSIC
ZnF_C2H2 1574 1596 2.24e-3 SMART
ZnF_C2H2 1602 1624 4.47e-3 SMART
low complexity region 1636 1651 N/A INTRINSIC
low complexity region 1692 1714 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124268
Predicted Effect probably benign
Transcript: ENSMUST00000124373
Predicted Effect possibly damaging
Transcript: ENSMUST00000128570
AA Change: Q1353K

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115599
Gene: ENSMUSG00000039087
AA Change: Q1353K

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
ZnF_C2H2 1279 1302 1.01e-1 SMART
low complexity region 1324 1339 N/A INTRINSIC
low complexity region 1370 1403 N/A INTRINSIC
ZnF_C2H2 1454 1476 6.13e-1 SMART
low complexity region 1501 1516 N/A INTRINSIC
low complexity region 1535 1548 N/A INTRINSIC
ZnF_C2H2 1574 1596 2.24e-3 SMART
ZnF_C2H2 1602 1624 4.47e-3 SMART
low complexity region 1636 1651 N/A INTRINSIC
low complexity region 1692 1714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162849
SMART Domains Protein: ENSMUSP00000124802
Gene: ENSMUSG00000039087

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
ZnF_C2H2 73 95 6.13e-1 SMART
low complexity region 120 135 N/A INTRINSIC
low complexity region 154 165 N/A INTRINSIC
ZnF_C2H2 168 190 4.47e-3 SMART
low complexity region 202 217 N/A INTRINSIC
low complexity region 258 280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor that binds to RAS-responsive elements (RREs) of gene promoters. It has been shown that the calcitonin gene promoter contains an RRE and that the encoded protein binds there and increases expression of calcitonin, which may be involved in Ras/Raf-mediated cell differentiation. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,626,012 Y268* probably null Het
Abca14 A T 7: 120,289,460 I1210F probably benign Het
Ankrd17 T C 5: 90,285,846 H688R possibly damaging Het
Arhgap24 T A 5: 102,664,106 N66K probably damaging Het
Atp1a1 C T 3: 101,590,466 G335D probably damaging Het
Cacna1g C T 11: 94,459,555 R488H possibly damaging Het
Cacna1h A T 17: 25,397,620 V149E probably damaging Het
Cd22 G T 7: 30,873,170 P338Q probably benign Het
Cntln G T 4: 85,096,839 M1122I probably benign Het
Cntrl A G 2: 35,122,756 N302S probably benign Het
Cog8 T C 8: 107,052,896 R250G probably damaging Het
Creld2 T C 15: 88,823,753 C232R probably damaging Het
Cyp2b23 G A 7: 26,673,149 P347L probably damaging Het
Dnah5 T C 15: 28,403,542 probably null Het
Eml6 C T 11: 30,024,459 V40I probably damaging Het
Epb42 C T 2: 121,029,967 probably null Het
Fcrla A G 1: 170,921,004 L190P probably damaging Het
Galnt18 A T 7: 111,779,428 Y40* probably null Het
Gdf7 A T 12: 8,298,073 M416K probably damaging Het
Gm11232 T A 4: 71,756,919 probably null Het
Gpam T A 19: 55,088,176 N198Y probably damaging Het
Grip1 C T 10: 119,986,350 S327F possibly damaging Het
Hey2 C T 10: 30,834,356 A134T probably benign Het
Kat6a T C 8: 22,938,652 I1341T probably benign Het
Kcnd3 T C 3: 105,668,186 L542P probably benign Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lman2 T C 13: 55,351,251 D234G probably benign Het
Map3k19 A C 1: 127,817,898 I1273R probably damaging Het
Matn1 T A 4: 130,950,019 F180I possibly damaging Het
Meikin T A 11: 54,370,941 L61* probably null Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Myh13 T C 11: 67,331,046 I199T probably damaging Het
Myh4 T A 11: 67,248,461 S535T probably damaging Het
Myo5a T C 9: 75,213,065 M1715T probably damaging Het
Nat8 A T 6: 85,830,989 V54D probably damaging Het
Nbea A G 3: 56,085,327 V286A probably damaging Het
Ndnf A G 6: 65,704,014 K426E possibly damaging Het
Nup210l T A 3: 90,190,972 N1410K possibly damaging Het
Oca2 A T 7: 56,321,521 T399S probably damaging Het
Olfr1045 A G 2: 86,198,252 S167P probably damaging Het
Olfr118 A T 17: 37,672,925 K301* probably null Het
Olfr250 G A 9: 38,368,196 V217I probably benign Het
Olfr366 A C 2: 37,219,659 T57P possibly damaging Het
Olfr644 A T 7: 104,068,459 C191S probably damaging Het
Olfr652 T A 7: 104,565,071 N283K probably damaging Het
Otogl A C 10: 107,878,152 probably null Het
Pde4b C T 4: 102,605,176 T511I probably damaging Het
Proser3 A G 7: 30,539,747 probably null Het
Psmd12 G A 11: 107,479,646 V24M probably damaging Het
Rbm17 A T 2: 11,593,461 M170K probably benign Het
Rims2 C T 15: 39,511,314 T1064I possibly damaging Het
Ripor3 C T 2: 167,992,653 V281M probably damaging Het
Sgo2a A G 1: 58,015,806 D383G probably benign Het
Sik3 C T 9: 46,221,148 T1346M probably damaging Het
Slx1b A T 7: 126,692,796 V63E probably damaging Het
Son A G 16: 91,657,086 D907G probably damaging Het
Src G A 2: 157,469,212 V401M probably damaging Het
St3gal4 T C 9: 35,054,757 K24E possibly damaging Het
Stat6 A G 10: 127,658,245 K647R probably damaging Het
Tbl1xr1 G A 3: 22,193,169 probably null Het
Tlk2 G A 11: 105,256,952 probably null Het
Tmbim6 T A 15: 99,401,615 I3K probably benign Het
Tmeff2 A T 1: 51,181,867 I334F probably damaging Het
Ttn T C 2: 76,840,315 probably null Het
Ubl7 T A 9: 57,914,611 I81N probably damaging Het
Ugt1a10 A G 1: 88,055,711 Y77C probably damaging Het
Uqcrfs1 A G 13: 30,540,907 C217R probably damaging Het
Usp50 T C 2: 126,761,634 T331A probably benign Het
Vmn1r65 A G 7: 6,009,157 V26A probably benign Het
Wdfy3 A C 5: 101,917,579 V1241G possibly damaging Het
Wtap A C 17: 12,981,744 probably null Het
Zbtb40 C A 4: 136,984,837 A1187S possibly damaging Het
Zfp57 T C 17: 37,006,098 S20P probably damaging Het
Zfp592 A G 7: 81,024,479 D397G probably damaging Het
Zfp747 A T 7: 127,374,504 S165T probably benign Het
Zfp949 C T 9: 88,569,838 T487I probably damaging Het
Zscan4d A G 7: 11,164,994 C119R probably damaging Het
Other mutations in Rreb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Rreb1 APN 13 37916496 missense probably benign 0.09
IGL00336:Rreb1 APN 13 37929646 nonsense probably null
IGL00473:Rreb1 APN 13 37930791 nonsense probably null
IGL01338:Rreb1 APN 13 37931034 missense probably damaging 1.00
IGL01836:Rreb1 APN 13 37931457 missense probably damaging 1.00
IGL02066:Rreb1 APN 13 37931506 missense probably benign 0.16
IGL02661:Rreb1 APN 13 37930802 nonsense probably null
IGL02739:Rreb1 APN 13 37893821 missense probably damaging 1.00
IGL03267:Rreb1 APN 13 37932193 missense probably benign 0.30
IGL03332:Rreb1 APN 13 37930916 missense probably benign 0.42
IGL03403:Rreb1 APN 13 37929574 missense possibly damaging 0.78
R0039:Rreb1 UTSW 13 37899637 missense probably damaging 1.00
R0039:Rreb1 UTSW 13 37899637 missense probably damaging 1.00
R0101:Rreb1 UTSW 13 37931542 missense probably benign 0.04
R0265:Rreb1 UTSW 13 37916155 nonsense probably null
R0635:Rreb1 UTSW 13 37941564 missense possibly damaging 0.92
R0939:Rreb1 UTSW 13 37932231 missense probably benign 0.09
R1099:Rreb1 UTSW 13 37948891 missense probably benign 0.16
R1438:Rreb1 UTSW 13 37930605 missense probably benign 0.16
R1510:Rreb1 UTSW 13 37931884 missense probably benign 0.04
R1672:Rreb1 UTSW 13 37930537 missense probably benign 0.09
R1772:Rreb1 UTSW 13 37930923 missense probably benign 0.09
R2171:Rreb1 UTSW 13 37930846 missense probably benign 0.00
R2371:Rreb1 UTSW 13 37916537 missense probably benign 0.09
R2566:Rreb1 UTSW 13 37929792 missense possibly damaging 0.62
R2571:Rreb1 UTSW 13 37899637 missense probably damaging 1.00
R2862:Rreb1 UTSW 13 37932453 missense probably benign 0.02
R2874:Rreb1 UTSW 13 37916508 missense probably benign 0.09
R2911:Rreb1 UTSW 13 37948920 missense probably benign 0.00
R3722:Rreb1 UTSW 13 37947098 missense probably benign 0.01
R3767:Rreb1 UTSW 13 37929603 missense possibly damaging 0.95
R3770:Rreb1 UTSW 13 37929603 missense possibly damaging 0.95
R3885:Rreb1 UTSW 13 37893965 missense probably damaging 1.00
R3886:Rreb1 UTSW 13 37898506 splice site probably null
R3887:Rreb1 UTSW 13 37893965 missense probably damaging 1.00
R3888:Rreb1 UTSW 13 37893965 missense probably damaging 1.00
R3889:Rreb1 UTSW 13 37893965 missense probably damaging 1.00
R4064:Rreb1 UTSW 13 37930317 missense probably benign 0.42
R4134:Rreb1 UTSW 13 37947123 missense probably damaging 1.00
R4135:Rreb1 UTSW 13 37947123 missense probably damaging 1.00
R4174:Rreb1 UTSW 13 37930150 missense possibly damaging 0.95
R4250:Rreb1 UTSW 13 37893893 missense possibly damaging 0.63
R4287:Rreb1 UTSW 13 37931931 missense probably benign 0.03
R4396:Rreb1 UTSW 13 37930443 nonsense probably null
R4658:Rreb1 UTSW 13 37948801 missense probably damaging 1.00
R4841:Rreb1 UTSW 13 37916526 missense probably benign 0.09
R4856:Rreb1 UTSW 13 37931058 missense possibly damaging 0.62
R4886:Rreb1 UTSW 13 37931058 missense possibly damaging 0.62
R5092:Rreb1 UTSW 13 37928278 missense probably benign 0.09
R5122:Rreb1 UTSW 13 37930768 missense probably benign 0.02
R5405:Rreb1 UTSW 13 37949111 missense probably damaging 0.99
R5408:Rreb1 UTSW 13 37931344 missense probably benign 0.01
R5446:Rreb1 UTSW 13 37898497 missense possibly damaging 0.78
R5641:Rreb1 UTSW 13 37947421 missense probably benign 0.00
R5859:Rreb1 UTSW 13 37947408 missense probably benign 0.24
R5859:Rreb1 UTSW 13 37947409 missense probably benign 0.06
R6429:Rreb1 UTSW 13 37932129 missense probably benign 0.03
R6678:Rreb1 UTSW 13 37899699 missense probably damaging 1.00
R7130:Rreb1 UTSW 13 37899748 missense probably damaging 1.00
R7186:Rreb1 UTSW 13 37941632 missense probably benign 0.02
R7188:Rreb1 UTSW 13 37916568 missense possibly damaging 0.79
R7387:Rreb1 UTSW 13 37947064 missense unknown
R7453:Rreb1 UTSW 13 37941569 missense probably damaging 0.98
R7492:Rreb1 UTSW 13 37931748 missense probably benign 0.00
R7585:Rreb1 UTSW 13 37893898 missense probably benign 0.07
R7621:Rreb1 UTSW 13 37949066 missense
R7645:Rreb1 UTSW 13 37931034 missense probably damaging 1.00
R7653:Rreb1 UTSW 13 37930386 missense probably benign 0.19
R7670:Rreb1 UTSW 13 37931572 missense probably benign 0.00
R7701:Rreb1 UTSW 13 37930116 missense possibly damaging 0.60
R7708:Rreb1 UTSW 13 37929570 missense probably benign 0.18
R7874:Rreb1 UTSW 13 37947124 missense probably damaging 1.00
R8103:Rreb1 UTSW 13 37941701 missense probably benign 0.16
R8129:Rreb1 UTSW 13 37929799 missense probably benign 0.00
R8239:Rreb1 UTSW 13 37893872 missense probably damaging 1.00
R8324:Rreb1 UTSW 13 37947621 missense probably damaging 1.00
X0024:Rreb1 UTSW 13 37931580 missense probably benign 0.09
X0026:Rreb1 UTSW 13 37931992 missense probably benign 0.17
Z1088:Rreb1 UTSW 13 37948937 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGAAGTCAGGAGTTCTGAGGCAC -3'
(R):5'- TGCCAGCTTGAAGTCCATCAGC -3'

Sequencing Primer
(F):5'- AGGTTTAGTATCCAGGATTCAAGG -3'
(R):5'- AAGATCCAGGCTCTGGTTGC -3'
Posted On2014-03-14