Incidental Mutation 'R1457:Rreb1'
ID 158601
Institutional Source Beutler Lab
Gene Symbol Rreb1
Ensembl Gene ENSMUSG00000039087
Gene Name ras responsive element binding protein 1
Synonyms 1110037N09Rik, B930013M22Rik
MMRRC Submission 039512-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R1457 (G1)
Quality Score 133
Status Not validated
Chromosome 13
Chromosomal Location 37962376-38135981 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 38130904 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 1353 (Q1353K)
Ref Sequence ENSEMBL: ENSMUSP00000115599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037232] [ENSMUST00000124373] [ENSMUST00000128570]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000037232
AA Change: Q1353K

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049265
Gene: ENSMUSG00000039087
AA Change: Q1353K

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
ZnF_C2H2 1279 1302 1.01e-1 SMART
low complexity region 1324 1339 N/A INTRINSIC
low complexity region 1370 1403 N/A INTRINSIC
ZnF_C2H2 1454 1476 6.13e-1 SMART
low complexity region 1501 1516 N/A INTRINSIC
low complexity region 1535 1548 N/A INTRINSIC
ZnF_C2H2 1574 1596 2.24e-3 SMART
ZnF_C2H2 1602 1624 4.47e-3 SMART
low complexity region 1636 1651 N/A INTRINSIC
low complexity region 1692 1714 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124268
Predicted Effect probably benign
Transcript: ENSMUST00000124373
Predicted Effect possibly damaging
Transcript: ENSMUST00000128570
AA Change: Q1353K

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115599
Gene: ENSMUSG00000039087
AA Change: Q1353K

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
ZnF_C2H2 1279 1302 1.01e-1 SMART
low complexity region 1324 1339 N/A INTRINSIC
low complexity region 1370 1403 N/A INTRINSIC
ZnF_C2H2 1454 1476 6.13e-1 SMART
low complexity region 1501 1516 N/A INTRINSIC
low complexity region 1535 1548 N/A INTRINSIC
ZnF_C2H2 1574 1596 2.24e-3 SMART
ZnF_C2H2 1602 1624 4.47e-3 SMART
low complexity region 1636 1651 N/A INTRINSIC
low complexity region 1692 1714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162849
SMART Domains Protein: ENSMUSP00000124802
Gene: ENSMUSG00000039087

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
ZnF_C2H2 73 95 6.13e-1 SMART
low complexity region 120 135 N/A INTRINSIC
low complexity region 154 165 N/A INTRINSIC
ZnF_C2H2 168 190 4.47e-3 SMART
low complexity region 202 217 N/A INTRINSIC
low complexity region 258 280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor that binds to RAS-responsive elements (RREs) of gene promoters. It has been shown that the calcitonin gene promoter contains an RRE and that the encoded protein binds there and increases expression of calcitonin, which may be involved in Ras/Raf-mediated cell differentiation. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 119,888,683 (GRCm39) I1210F probably benign Het
Ankrd17 T C 5: 90,433,705 (GRCm39) H688R possibly damaging Het
Arhgap24 T A 5: 102,811,972 (GRCm39) N66K probably damaging Het
Atp1a1 C T 3: 101,497,782 (GRCm39) G335D probably damaging Het
Cacna1g C T 11: 94,350,381 (GRCm39) R488H possibly damaging Het
Cacna1h A T 17: 25,616,594 (GRCm39) V149E probably damaging Het
Cd22 G T 7: 30,572,595 (GRCm39) P338Q probably benign Het
Cntln G T 4: 85,015,076 (GRCm39) M1122I probably benign Het
Cntrl A G 2: 35,012,768 (GRCm39) N302S probably benign Het
Cog8 T C 8: 107,779,528 (GRCm39) R250G probably damaging Het
Cracdl A T 1: 37,665,093 (GRCm39) Y268* probably null Het
Creld2 T C 15: 88,707,956 (GRCm39) C232R probably damaging Het
Cyp2b23 G A 7: 26,372,574 (GRCm39) P347L probably damaging Het
Dnah5 T C 15: 28,403,688 (GRCm39) probably null Het
Eml6 C T 11: 29,974,459 (GRCm39) V40I probably damaging Het
Epb42 C T 2: 120,860,448 (GRCm39) probably null Het
Fcrla A G 1: 170,748,573 (GRCm39) L190P probably damaging Het
Galnt18 A T 7: 111,378,635 (GRCm39) Y40* probably null Het
Gdf7 A T 12: 8,348,073 (GRCm39) M416K probably damaging Het
Gm11232 T A 4: 71,675,156 (GRCm39) probably null Het
Gpam T A 19: 55,076,608 (GRCm39) N198Y probably damaging Het
Grip1 C T 10: 119,822,255 (GRCm39) S327F possibly damaging Het
Hey2 C T 10: 30,710,352 (GRCm39) A134T probably benign Het
Kat6a T C 8: 23,428,668 (GRCm39) I1341T probably benign Het
Kcnd3 T C 3: 105,575,502 (GRCm39) L542P probably benign Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lman2 T C 13: 55,499,064 (GRCm39) D234G probably benign Het
Map3k19 A C 1: 127,745,635 (GRCm39) I1273R probably damaging Het
Matn1 T A 4: 130,677,330 (GRCm39) F180I possibly damaging Het
Meikin T A 11: 54,261,767 (GRCm39) L61* probably null Het
Mroh2b G T 15: 4,955,166 (GRCm39) D720Y probably damaging Het
Myh13 T C 11: 67,221,872 (GRCm39) I199T probably damaging Het
Myh4 T A 11: 67,139,287 (GRCm39) S535T probably damaging Het
Myo5a T C 9: 75,120,347 (GRCm39) M1715T probably damaging Het
Nat8 A T 6: 85,807,971 (GRCm39) V54D probably damaging Het
Nbea A G 3: 55,992,748 (GRCm39) V286A probably damaging Het
Ndnf A G 6: 65,680,998 (GRCm39) K426E possibly damaging Het
Nup210l T A 3: 90,098,279 (GRCm39) N1410K possibly damaging Het
Oca2 A T 7: 55,971,269 (GRCm39) T399S probably damaging Het
Or10al2 A T 17: 37,983,816 (GRCm39) K301* probably null Het
Or1af1 A C 2: 37,109,671 (GRCm39) T57P possibly damaging Het
Or51a43 A T 7: 103,717,666 (GRCm39) C191S probably damaging Het
Or52h7 T A 7: 104,214,278 (GRCm39) N283K probably damaging Het
Or8c10 G A 9: 38,279,492 (GRCm39) V217I probably benign Het
Or8j3 A G 2: 86,028,596 (GRCm39) S167P probably damaging Het
Otogl A C 10: 107,714,013 (GRCm39) probably null Het
Pde4b C T 4: 102,462,373 (GRCm39) T511I probably damaging Het
Proser3 A G 7: 30,239,172 (GRCm39) probably null Het
Psmd12 G A 11: 107,370,472 (GRCm39) V24M probably damaging Het
Rbm17 A T 2: 11,598,272 (GRCm39) M170K probably benign Het
Rims2 C T 15: 39,374,710 (GRCm39) T1064I possibly damaging Het
Ripor3 C T 2: 167,834,573 (GRCm39) V281M probably damaging Het
Sgo2a A G 1: 58,054,965 (GRCm39) D383G probably benign Het
Sik3 C T 9: 46,132,446 (GRCm39) T1346M probably damaging Het
Slx1b A T 7: 126,291,968 (GRCm39) V63E probably damaging Het
Son A G 16: 91,453,974 (GRCm39) D907G probably damaging Het
Src G A 2: 157,311,132 (GRCm39) V401M probably damaging Het
St3gal4 T C 9: 34,966,053 (GRCm39) K24E possibly damaging Het
Stat6 A G 10: 127,494,114 (GRCm39) K647R probably damaging Het
Tbl1xr1 G A 3: 22,247,333 (GRCm39) probably null Het
Tlk2 G A 11: 105,147,778 (GRCm39) probably null Het
Tmbim6 T A 15: 99,299,496 (GRCm39) I3K probably benign Het
Tmeff2 A T 1: 51,221,026 (GRCm39) I334F probably damaging Het
Ttn T C 2: 76,670,659 (GRCm39) probably null Het
Ubl7 T A 9: 57,821,894 (GRCm39) I81N probably damaging Het
Ugt1a10 A G 1: 87,983,433 (GRCm39) Y77C probably damaging Het
Uqcrfs1 A G 13: 30,724,890 (GRCm39) C217R probably damaging Het
Usp50 T C 2: 126,603,554 (GRCm39) T331A probably benign Het
Vmn1r65 A G 7: 6,012,156 (GRCm39) V26A probably benign Het
Wdfy3 A C 5: 102,065,445 (GRCm39) V1241G possibly damaging Het
Wtap A C 17: 13,200,631 (GRCm39) probably null Het
Zbtb40 C A 4: 136,712,148 (GRCm39) A1187S possibly damaging Het
Zfp57 T C 17: 37,316,990 (GRCm39) S20P probably damaging Het
Zfp592 A G 7: 80,674,227 (GRCm39) D397G probably damaging Het
Zfp747 A T 7: 126,973,676 (GRCm39) S165T probably benign Het
Zfp949 C T 9: 88,451,891 (GRCm39) T487I probably damaging Het
Zscan4d A G 7: 10,898,921 (GRCm39) C119R probably damaging Het
Other mutations in Rreb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Rreb1 APN 13 38,100,472 (GRCm39) missense probably benign 0.09
IGL00336:Rreb1 APN 13 38,113,622 (GRCm39) nonsense probably null
IGL00473:Rreb1 APN 13 38,114,767 (GRCm39) nonsense probably null
IGL01338:Rreb1 APN 13 38,115,010 (GRCm39) missense probably damaging 1.00
IGL01836:Rreb1 APN 13 38,115,433 (GRCm39) missense probably damaging 1.00
IGL02066:Rreb1 APN 13 38,115,482 (GRCm39) missense probably benign 0.16
IGL02661:Rreb1 APN 13 38,114,778 (GRCm39) nonsense probably null
IGL02739:Rreb1 APN 13 38,077,797 (GRCm39) missense probably damaging 1.00
IGL03267:Rreb1 APN 13 38,116,169 (GRCm39) missense probably benign 0.30
IGL03332:Rreb1 APN 13 38,114,892 (GRCm39) missense probably benign 0.42
IGL03403:Rreb1 APN 13 38,113,550 (GRCm39) missense possibly damaging 0.78
R0039:Rreb1 UTSW 13 38,083,613 (GRCm39) missense probably damaging 1.00
R0039:Rreb1 UTSW 13 38,083,613 (GRCm39) missense probably damaging 1.00
R0101:Rreb1 UTSW 13 38,115,518 (GRCm39) missense probably benign 0.04
R0265:Rreb1 UTSW 13 38,100,131 (GRCm39) nonsense probably null
R0635:Rreb1 UTSW 13 38,125,540 (GRCm39) missense possibly damaging 0.92
R0939:Rreb1 UTSW 13 38,116,207 (GRCm39) missense probably benign 0.09
R1099:Rreb1 UTSW 13 38,132,867 (GRCm39) missense probably benign 0.16
R1438:Rreb1 UTSW 13 38,114,581 (GRCm39) missense probably benign 0.16
R1510:Rreb1 UTSW 13 38,115,860 (GRCm39) missense probably benign 0.04
R1672:Rreb1 UTSW 13 38,114,513 (GRCm39) missense probably benign 0.09
R1772:Rreb1 UTSW 13 38,114,899 (GRCm39) missense probably benign 0.09
R2171:Rreb1 UTSW 13 38,114,822 (GRCm39) missense probably benign 0.00
R2371:Rreb1 UTSW 13 38,100,513 (GRCm39) missense probably benign 0.09
R2566:Rreb1 UTSW 13 38,113,768 (GRCm39) missense possibly damaging 0.62
R2571:Rreb1 UTSW 13 38,083,613 (GRCm39) missense probably damaging 1.00
R2862:Rreb1 UTSW 13 38,116,429 (GRCm39) missense probably benign 0.02
R2874:Rreb1 UTSW 13 38,100,484 (GRCm39) missense probably benign 0.09
R2911:Rreb1 UTSW 13 38,132,896 (GRCm39) missense probably benign 0.00
R3722:Rreb1 UTSW 13 38,131,074 (GRCm39) missense probably benign 0.01
R3767:Rreb1 UTSW 13 38,113,579 (GRCm39) missense possibly damaging 0.95
R3770:Rreb1 UTSW 13 38,113,579 (GRCm39) missense possibly damaging 0.95
R3885:Rreb1 UTSW 13 38,077,941 (GRCm39) missense probably damaging 1.00
R3886:Rreb1 UTSW 13 38,082,482 (GRCm39) splice site probably null
R3887:Rreb1 UTSW 13 38,077,941 (GRCm39) missense probably damaging 1.00
R3888:Rreb1 UTSW 13 38,077,941 (GRCm39) missense probably damaging 1.00
R3889:Rreb1 UTSW 13 38,077,941 (GRCm39) missense probably damaging 1.00
R4064:Rreb1 UTSW 13 38,114,293 (GRCm39) missense probably benign 0.42
R4134:Rreb1 UTSW 13 38,131,099 (GRCm39) missense probably damaging 1.00
R4135:Rreb1 UTSW 13 38,131,099 (GRCm39) missense probably damaging 1.00
R4174:Rreb1 UTSW 13 38,114,126 (GRCm39) missense possibly damaging 0.95
R4250:Rreb1 UTSW 13 38,077,869 (GRCm39) missense possibly damaging 0.63
R4287:Rreb1 UTSW 13 38,115,907 (GRCm39) missense probably benign 0.03
R4396:Rreb1 UTSW 13 38,114,419 (GRCm39) nonsense probably null
R4658:Rreb1 UTSW 13 38,132,777 (GRCm39) missense probably damaging 1.00
R4841:Rreb1 UTSW 13 38,100,502 (GRCm39) missense probably benign 0.09
R4856:Rreb1 UTSW 13 38,115,034 (GRCm39) missense possibly damaging 0.62
R4886:Rreb1 UTSW 13 38,115,034 (GRCm39) missense possibly damaging 0.62
R5092:Rreb1 UTSW 13 38,112,254 (GRCm39) missense probably benign 0.09
R5122:Rreb1 UTSW 13 38,114,744 (GRCm39) missense probably benign 0.02
R5405:Rreb1 UTSW 13 38,133,087 (GRCm39) missense probably damaging 0.99
R5408:Rreb1 UTSW 13 38,115,320 (GRCm39) missense probably benign 0.01
R5446:Rreb1 UTSW 13 38,082,473 (GRCm39) missense possibly damaging 0.78
R5641:Rreb1 UTSW 13 38,131,397 (GRCm39) missense probably benign 0.00
R5859:Rreb1 UTSW 13 38,131,385 (GRCm39) missense probably benign 0.06
R5859:Rreb1 UTSW 13 38,131,384 (GRCm39) missense probably benign 0.24
R6429:Rreb1 UTSW 13 38,116,105 (GRCm39) missense probably benign 0.03
R6678:Rreb1 UTSW 13 38,083,675 (GRCm39) missense probably damaging 1.00
R7130:Rreb1 UTSW 13 38,083,724 (GRCm39) missense probably damaging 1.00
R7186:Rreb1 UTSW 13 38,125,608 (GRCm39) missense probably benign 0.02
R7188:Rreb1 UTSW 13 38,100,544 (GRCm39) missense possibly damaging 0.79
R7387:Rreb1 UTSW 13 38,131,040 (GRCm39) missense unknown
R7453:Rreb1 UTSW 13 38,125,545 (GRCm39) missense probably damaging 0.98
R7492:Rreb1 UTSW 13 38,115,724 (GRCm39) missense probably benign 0.00
R7585:Rreb1 UTSW 13 38,077,874 (GRCm39) missense probably benign 0.07
R7621:Rreb1 UTSW 13 38,133,042 (GRCm39) missense
R7645:Rreb1 UTSW 13 38,115,010 (GRCm39) missense probably damaging 1.00
R7653:Rreb1 UTSW 13 38,114,362 (GRCm39) missense probably benign 0.19
R7670:Rreb1 UTSW 13 38,115,548 (GRCm39) missense probably benign 0.00
R7701:Rreb1 UTSW 13 38,114,092 (GRCm39) missense possibly damaging 0.60
R7708:Rreb1 UTSW 13 38,113,546 (GRCm39) missense probably benign 0.18
R7874:Rreb1 UTSW 13 38,131,100 (GRCm39) missense probably damaging 1.00
R8103:Rreb1 UTSW 13 38,125,677 (GRCm39) missense probably benign 0.16
R8129:Rreb1 UTSW 13 38,113,775 (GRCm39) missense probably benign 0.00
R8239:Rreb1 UTSW 13 38,077,848 (GRCm39) missense probably damaging 1.00
R8324:Rreb1 UTSW 13 38,131,597 (GRCm39) missense probably damaging 1.00
R8824:Rreb1 UTSW 13 38,114,492 (GRCm39) missense probably damaging 0.99
R8910:Rreb1 UTSW 13 38,132,741 (GRCm39) missense
R8992:Rreb1 UTSW 13 38,114,352 (GRCm39) missense probably benign 0.30
R9064:Rreb1 UTSW 13 38,115,326 (GRCm39) missense possibly damaging 0.94
R9087:Rreb1 UTSW 13 38,115,644 (GRCm39) missense probably benign 0.33
R9130:Rreb1 UTSW 13 38,114,282 (GRCm39) missense probably benign 0.29
R9582:Rreb1 UTSW 13 38,114,734 (GRCm39) missense probably benign 0.29
R9602:Rreb1 UTSW 13 38,114,477 (GRCm39) missense probably damaging 0.99
R9774:Rreb1 UTSW 13 38,114,185 (GRCm39) missense probably benign 0.18
X0024:Rreb1 UTSW 13 38,115,556 (GRCm39) missense probably benign 0.09
X0026:Rreb1 UTSW 13 38,115,968 (GRCm39) missense probably benign 0.17
Z1088:Rreb1 UTSW 13 38,132,913 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGAAGTCAGGAGTTCTGAGGCAC -3'
(R):5'- TGCCAGCTTGAAGTCCATCAGC -3'

Sequencing Primer
(F):5'- AGGTTTAGTATCCAGGATTCAAGG -3'
(R):5'- AAGATCCAGGCTCTGGTTGC -3'
Posted On 2014-03-14