Mutagenetix > Incidental Mutation

Incidental Mutation 'R1457:Lman2'

158603

Institutional Source

Beutler Lab

Gene Symbol

Lman2

Ensembl Gene

ENSMUSG00000021484

Gene Name

lectin, mannose-binding 2

Synonyms

1300009F09Rik, 1110003H06Rik, VIP36, GP36B

MMRRC Submission

039512-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.292) question?

Stock #

R1457 (G1)

Quality Score

207

Status

Not validated

Chromosome

Chromosomal Location

55343833-55362783 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 55351251 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 234 (D234G)

Ref Sequence

ENSEMBL: ENSMUSP00000021940 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021940]

AlphaFold

Q9DBH5

Predicted Effect

probably benign
Transcript: ENSMUST00000021940
AA Change: D234G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000021940
Gene: ENSMUSG00000021484
AA Change: D234G

Domain	Start	End	E-Value	Type
signal peptide	1	46	N/A	INTRINSIC
Pfam:Lectin_leg-like	54	280	6.6e-104	PFAM
transmembrane domain	325	347	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224517

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225066

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.7%
20x: 87.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane lectin that shuttles between the endoplasmic reticulum, the Golgi apparatus and the plasma membrane. The encoded protein binds high mannose type glycoproteins and may facilitate their sorting, trafficking and quality control. [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	A	T	1: 37,626,012	Y268*	probably null	Het
Abca14	A	T	7: 120,289,460	I1210F	probably benign	Het
Ankrd17	T	C	5: 90,285,846	H688R	possibly damaging	Het
Arhgap24	T	A	5: 102,664,106	N66K	probably damaging	Het
Atp1a1	C	T	3: 101,590,466	G335D	probably damaging	Het
Cacna1g	C	T	11: 94,459,555	R488H	possibly damaging	Het
Cacna1h	A	T	17: 25,397,620	V149E	probably damaging	Het
Cd22	G	T	7: 30,873,170	P338Q	probably benign	Het
Cntln	G	T	4: 85,096,839	M1122I	probably benign	Het
Cntrl	A	G	2: 35,122,756	N302S	probably benign	Het
Cog8	T	C	8: 107,052,896	R250G	probably damaging	Het
Creld2	T	C	15: 88,823,753	C232R	probably damaging	Het
Cyp2b23	G	A	7: 26,673,149	P347L	probably damaging	Het
Dnah5	T	C	15: 28,403,542		probably null	Het
Eml6	C	T	11: 30,024,459	V40I	probably damaging	Het
Epb42	C	T	2: 121,029,967		probably null	Het
Fcrla	A	G	1: 170,921,004	L190P	probably damaging	Het
Galnt18	A	T	7: 111,779,428	Y40*	probably null	Het
Gdf7	A	T	12: 8,298,073	M416K	probably damaging	Het
Gm11232	T	A	4: 71,756,919		probably null	Het
Gpam	T	A	19: 55,088,176	N198Y	probably damaging	Het
Grip1	C	T	10: 119,986,350	S327F	possibly damaging	Het
Hey2	C	T	10: 30,834,356	A134T	probably benign	Het
Kat6a	T	C	8: 22,938,652	I1341T	probably benign	Het
Kcnd3	T	C	3: 105,668,186	L542P	probably benign	Het
Lars	G	A	18: 42,210,050	R1101C	probably damaging	Het
Map3k19	A	C	1: 127,817,898	I1273R	probably damaging	Het
Matn1	T	A	4: 130,950,019	F180I	possibly damaging	Het
Meikin	T	A	11: 54,370,941	L61*	probably null	Het
Mroh2b	G	T	15: 4,925,684	D720Y	probably damaging	Het
Myh13	T	C	11: 67,331,046	I199T	probably damaging	Het
Myh4	T	A	11: 67,248,461	S535T	probably damaging	Het
Myo5a	T	C	9: 75,213,065	M1715T	probably damaging	Het
Nat8	A	T	6: 85,830,989	V54D	probably damaging	Het
Nbea	A	G	3: 56,085,327	V286A	probably damaging	Het
Ndnf	A	G	6: 65,704,014	K426E	possibly damaging	Het
Nup210l	T	A	3: 90,190,972	N1410K	possibly damaging	Het
Oca2	A	T	7: 56,321,521	T399S	probably damaging	Het
Olfr1045	A	G	2: 86,198,252	S167P	probably damaging	Het
Olfr118	A	T	17: 37,672,925	K301*	probably null	Het
Olfr250	G	A	9: 38,368,196	V217I	probably benign	Het
Olfr366	A	C	2: 37,219,659	T57P	possibly damaging	Het
Olfr644	A	T	7: 104,068,459	C191S	probably damaging	Het
Olfr652	T	A	7: 104,565,071	N283K	probably damaging	Het
Otogl	A	C	10: 107,878,152		probably null	Het
Pde4b	C	T	4: 102,605,176	T511I	probably damaging	Het
Proser3	A	G	7: 30,539,747		probably null	Het
Psmd12	G	A	11: 107,479,646	V24M	probably damaging	Het
Rbm17	A	T	2: 11,593,461	M170K	probably benign	Het
Rims2	C	T	15: 39,511,314	T1064I	possibly damaging	Het
Ripor3	C	T	2: 167,992,653	V281M	probably damaging	Het
Rreb1	C	A	13: 37,946,928	Q1353K	possibly damaging	Het
Sgo2a	A	G	1: 58,015,806	D383G	probably benign	Het
Sik3	C	T	9: 46,221,148	T1346M	probably damaging	Het
Slx1b	A	T	7: 126,692,796	V63E	probably damaging	Het
Son	A	G	16: 91,657,086	D907G	probably damaging	Het
Src	G	A	2: 157,469,212	V401M	probably damaging	Het
St3gal4	T	C	9: 35,054,757	K24E	possibly damaging	Het
Stat6	A	G	10: 127,658,245	K647R	probably damaging	Het
Tbl1xr1	G	A	3: 22,193,169		probably null	Het
Tlk2	G	A	11: 105,256,952		probably null	Het
Tmbim6	T	A	15: 99,401,615	I3K	probably benign	Het
Tmeff2	A	T	1: 51,181,867	I334F	probably damaging	Het
Ttn	T	C	2: 76,840,315		probably null	Het
Ubl7	T	A	9: 57,914,611	I81N	probably damaging	Het
Ugt1a10	A	G	1: 88,055,711	Y77C	probably damaging	Het
Uqcrfs1	A	G	13: 30,540,907	C217R	probably damaging	Het
Usp50	T	C	2: 126,761,634	T331A	probably benign	Het
Vmn1r65	A	G	7: 6,009,157	V26A	probably benign	Het
Wdfy3	A	C	5: 101,917,579	V1241G	possibly damaging	Het
Wtap	A	C	17: 12,981,744		probably null	Het
Zbtb40	C	A	4: 136,984,837	A1187S	possibly damaging	Het
Zfp57	T	C	17: 37,006,098	S20P	probably damaging	Het
Zfp592	A	G	7: 81,024,479	D397G	probably damaging	Het
Zfp747	A	T	7: 127,374,504	S165T	probably benign	Het
Zfp949	C	T	9: 88,569,838	T487I	probably damaging	Het
Zscan4d	A	G	7: 11,164,994	C119R	probably damaging	Het

Other mutations in Lman2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00534:Lman2	APN	13	55351242	missense	possibly damaging	0.91
IGL02381:Lman2	APN	13	55351469	missense	possibly damaging	0.77
R0331:Lman2	UTSW	13	55353016	missense	probably damaging	1.00
R1482:Lman2	UTSW	13	55351405	missense	possibly damaging	0.92
R2209:Lman2	UTSW	13	55351502	missense	probably damaging	0.99
R2347:Lman2	UTSW	13	55352999	missense	possibly damaging	0.91
R6132:Lman2	UTSW	13	55362225	missense	probably benign
R6297:Lman2	UTSW	13	55348431	missense	probably damaging	0.99
R6461:Lman2	UTSW	13	55346915	missense	probably damaging	1.00
R7148:Lman2	UTSW	13	55352949	missense	probably benign	0.04
R7422:Lman2	UTSW	13	55351525	missense	probably damaging	1.00
R7498:Lman2	UTSW	13	55346977	missense	probably damaging	1.00
R7720:Lman2	UTSW	13	55353077	splice site	probably null
R8826:Lman2	UTSW	13	55362555	missense	unknown
R8872:Lman2	UTSW	13	55348384	missense	probably benign	0.02
R9007:Lman2	UTSW	13	55352960	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CCAAGGTGTGTTATCCCAGGCAAC -3'
(R):5'- CGGTGATGGTGAACAATGGCTCTC -3'

Sequencing Primer
(F):5'- GGGAGACTAAACACCTGTGTTC -3'
(R):5'- TGAACAATGGCTCTCTGTCG -3'

Posted On

2014-03-14