Mutagenetix > Incidental Mutation

Incidental Mutation 'R1457:Rims2'

158607

Institutional Source

Beutler Lab

Gene Symbol

Rims2

Ensembl Gene

ENSMUSG00000037386

Gene Name

regulating synaptic membrane exocytosis 2

Synonyms

2810036I15Rik, Syt3-rs, RIM2

MMRRC Submission

039512-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.490) question?

Stock #

R1457 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

39198261-39684372 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 39511314 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1064 (T1064I)

Ref Sequence

ENSEMBL: ENSMUSP00000080711 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042917] [ENSMUST00000082054] [ENSMUST00000227243]

AlphaFold

Q9EQZ7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042917
AA Change: T1024I

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000048719
Gene: ENSMUSG00000037386
AA Change: T1024I

Domain	Start	End	E-Value	Type
low complexity region	3	24	N/A	INTRINSIC
Pfam:FYVE_2	30	154	9.5e-18	PFAM
low complexity region	315	335	N/A	INTRINSIC
low complexity region	492	498	N/A	INTRINSIC
low complexity region	511	521	N/A	INTRINSIC
low complexity region	527	540	N/A	INTRINSIC
PDZ	646	725	8.27e-16	SMART
low complexity region	740	748	N/A	INTRINSIC
C2	790	897	4.08e-21	SMART
low complexity region	905	919	N/A	INTRINSIC
low complexity region	1085	1101	N/A	INTRINSIC
low complexity region	1116	1130	N/A	INTRINSIC
low complexity region	1208	1238	N/A	INTRINSIC
C2	1432	1535	3.78e-16	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000082054
AA Change: T1064I

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000080711
Gene: ENSMUSG00000037386
AA Change: T1064I

Domain	Start	End	E-Value	Type
low complexity region	3	24	N/A	INTRINSIC
Pfam:FYVE_2	76	194	2.2e-11	PFAM
low complexity region	355	375	N/A	INTRINSIC
low complexity region	532	538	N/A	INTRINSIC
low complexity region	551	561	N/A	INTRINSIC
low complexity region	567	580	N/A	INTRINSIC
PDZ	686	765	8.27e-16	SMART
low complexity region	780	788	N/A	INTRINSIC
C2	830	937	4.08e-21	SMART
low complexity region	945	959	N/A	INTRINSIC
low complexity region	1075	1086	N/A	INTRINSIC
low complexity region	1166	1196	N/A	INTRINSIC
C2	1390	1493	3.78e-16	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000227243
AA Change: T1024I

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

unknown
Transcript: ENSMUST00000227381
AA Change: T744I

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.7%
20x: 87.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a presynaptic protein that interacts with RAB3, a protein important for normal neurotransmitter release. The encoded protein can also bind several other synaptic proteins, including UNC-13 homolog B, ELKS/Rab6-interacting/CAST family member 1, and synaptotagmin 1. This protein is involved in synaptic membrane exocytosis. Polymorphisms in this gene have been associated with degenerative lumbar scoliosis. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body size, aberrant insulin granule exocytosis, and impaired secretion of hormones associated with glucose homeostasis. Mice homozygous for another knock-out allele show a slightly reduced body size, abnormal maternal behavior and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	A	T	1: 37,626,012	Y268*	probably null	Het
Abca14	A	T	7: 120,289,460	I1210F	probably benign	Het
Ankrd17	T	C	5: 90,285,846	H688R	possibly damaging	Het
Arhgap24	T	A	5: 102,664,106	N66K	probably damaging	Het
Atp1a1	C	T	3: 101,590,466	G335D	probably damaging	Het
Cacna1g	C	T	11: 94,459,555	R488H	possibly damaging	Het
Cacna1h	A	T	17: 25,397,620	V149E	probably damaging	Het
Cd22	G	T	7: 30,873,170	P338Q	probably benign	Het
Cntln	G	T	4: 85,096,839	M1122I	probably benign	Het
Cntrl	A	G	2: 35,122,756	N302S	probably benign	Het
Cog8	T	C	8: 107,052,896	R250G	probably damaging	Het
Creld2	T	C	15: 88,823,753	C232R	probably damaging	Het
Cyp2b23	G	A	7: 26,673,149	P347L	probably damaging	Het
Dnah5	T	C	15: 28,403,542		probably null	Het
Eml6	C	T	11: 30,024,459	V40I	probably damaging	Het
Epb42	C	T	2: 121,029,967		probably null	Het
Fcrla	A	G	1: 170,921,004	L190P	probably damaging	Het
Galnt18	A	T	7: 111,779,428	Y40*	probably null	Het
Gdf7	A	T	12: 8,298,073	M416K	probably damaging	Het
Gm11232	T	A	4: 71,756,919		probably null	Het
Gpam	T	A	19: 55,088,176	N198Y	probably damaging	Het
Grip1	C	T	10: 119,986,350	S327F	possibly damaging	Het
Hey2	C	T	10: 30,834,356	A134T	probably benign	Het
Kat6a	T	C	8: 22,938,652	I1341T	probably benign	Het
Kcnd3	T	C	3: 105,668,186	L542P	probably benign	Het
Lars	G	A	18: 42,210,050	R1101C	probably damaging	Het
Lman2	T	C	13: 55,351,251	D234G	probably benign	Het
Map3k19	A	C	1: 127,817,898	I1273R	probably damaging	Het
Matn1	T	A	4: 130,950,019	F180I	possibly damaging	Het
Meikin	T	A	11: 54,370,941	L61*	probably null	Het
Mroh2b	G	T	15: 4,925,684	D720Y	probably damaging	Het
Myh13	T	C	11: 67,331,046	I199T	probably damaging	Het
Myh4	T	A	11: 67,248,461	S535T	probably damaging	Het
Myo5a	T	C	9: 75,213,065	M1715T	probably damaging	Het
Nat8	A	T	6: 85,830,989	V54D	probably damaging	Het
Nbea	A	G	3: 56,085,327	V286A	probably damaging	Het
Ndnf	A	G	6: 65,704,014	K426E	possibly damaging	Het
Nup210l	T	A	3: 90,190,972	N1410K	possibly damaging	Het
Oca2	A	T	7: 56,321,521	T399S	probably damaging	Het
Olfr1045	A	G	2: 86,198,252	S167P	probably damaging	Het
Olfr118	A	T	17: 37,672,925	K301*	probably null	Het
Olfr250	G	A	9: 38,368,196	V217I	probably benign	Het
Olfr366	A	C	2: 37,219,659	T57P	possibly damaging	Het
Olfr644	A	T	7: 104,068,459	C191S	probably damaging	Het
Olfr652	T	A	7: 104,565,071	N283K	probably damaging	Het
Otogl	A	C	10: 107,878,152		probably null	Het
Pde4b	C	T	4: 102,605,176	T511I	probably damaging	Het
Proser3	A	G	7: 30,539,747		probably null	Het
Psmd12	G	A	11: 107,479,646	V24M	probably damaging	Het
Rbm17	A	T	2: 11,593,461	M170K	probably benign	Het
Ripor3	C	T	2: 167,992,653	V281M	probably damaging	Het
Rreb1	C	A	13: 37,946,928	Q1353K	possibly damaging	Het
Sgo2a	A	G	1: 58,015,806	D383G	probably benign	Het
Sik3	C	T	9: 46,221,148	T1346M	probably damaging	Het
Slx1b	A	T	7: 126,692,796	V63E	probably damaging	Het
Son	A	G	16: 91,657,086	D907G	probably damaging	Het
Src	G	A	2: 157,469,212	V401M	probably damaging	Het
St3gal4	T	C	9: 35,054,757	K24E	possibly damaging	Het
Stat6	A	G	10: 127,658,245	K647R	probably damaging	Het
Tbl1xr1	G	A	3: 22,193,169		probably null	Het
Tlk2	G	A	11: 105,256,952		probably null	Het
Tmbim6	T	A	15: 99,401,615	I3K	probably benign	Het
Tmeff2	A	T	1: 51,181,867	I334F	probably damaging	Het
Ttn	T	C	2: 76,840,315		probably null	Het
Ubl7	T	A	9: 57,914,611	I81N	probably damaging	Het
Ugt1a10	A	G	1: 88,055,711	Y77C	probably damaging	Het
Uqcrfs1	A	G	13: 30,540,907	C217R	probably damaging	Het
Usp50	T	C	2: 126,761,634	T331A	probably benign	Het
Vmn1r65	A	G	7: 6,009,157	V26A	probably benign	Het
Wdfy3	A	C	5: 101,917,579	V1241G	possibly damaging	Het
Wtap	A	C	17: 12,981,744		probably null	Het
Zbtb40	C	A	4: 136,984,837	A1187S	possibly damaging	Het
Zfp57	T	C	17: 37,006,098	S20P	probably damaging	Het
Zfp592	A	G	7: 81,024,479	D397G	probably damaging	Het
Zfp747	A	T	7: 127,374,504	S165T	probably benign	Het
Zfp949	C	T	9: 88,569,838	T487I	probably damaging	Het
Zscan4d	A	G	7: 11,164,994	C119R	probably damaging	Het

Other mutations in Rims2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Rims2	APN	15	39459615	missense	probably benign	0.11
IGL00502:Rims2	APN	15	39506984	missense	probably damaging	1.00
IGL00556:Rims2	APN	15	39456674	splice site	probably null
IGL00811:Rims2	APN	15	39292149	missense	probably damaging	1.00
IGL00827:Rims2	APN	15	39472359	missense	probably damaging	0.99
IGL01642:Rims2	APN	15	39457796	missense	probably damaging	1.00
IGL02951:Rims2	APN	15	39534938	missense	probably damaging	1.00
IGL03009:Rims2	APN	15	39566997	missense	possibly damaging	0.85
IGL03080:Rims2	APN	15	39535903	missense	probably damaging	1.00
IGL03102:Rims2	APN	15	39459593	missense	possibly damaging	0.95
IGL03252:Rims2	APN	15	39452352	missense	probably benign
IGL03365:Rims2	APN	15	39476541	missense	probably damaging	1.00
IGL03393:Rims2	APN	15	39462613	splice site	probably null
IGL03409:Rims2	APN	15	39456733	missense	probably damaging	1.00
rhyme	UTSW	15	39452328	missense	probably damaging	1.00
PIT4486001:Rims2	UTSW	15	39476520	missense	possibly damaging	0.67
R0009:Rims2	UTSW	15	39534966	missense	probably damaging	0.99
R0009:Rims2	UTSW	15	39534966	missense	probably damaging	0.99
R0078:Rims2	UTSW	15	39534855	missense	probably benign	0.42
R0367:Rims2	UTSW	15	39462615	splice site	probably null
R0401:Rims2	UTSW	15	39509632	splice site	probably benign
R0531:Rims2	UTSW	15	39567030	missense	probably damaging	1.00
R0791:Rims2	UTSW	15	39679625	splice site	probably benign
R0838:Rims2	UTSW	15	39681025	missense	probably benign	0.02
R1201:Rims2	UTSW	15	39616324	missense	possibly damaging	0.91
R1318:Rims2	UTSW	15	39517826	missense	probably damaging	0.99
R1619:Rims2	UTSW	15	39506986	missense	probably damaging	1.00
R1672:Rims2	UTSW	15	39292189	missense	probably benign	0.09
R1743:Rims2	UTSW	15	39679650	missense	probably benign	0.10
R1766:Rims2	UTSW	15	39462580	missense	probably damaging	0.99
R1779:Rims2	UTSW	15	39681702	missense	probably damaging	1.00
R1804:Rims2	UTSW	15	39437043	nonsense	probably null
R1985:Rims2	UTSW	15	39345314	missense	probably damaging	0.99
R1986:Rims2	UTSW	15	39345314	missense	probably damaging	0.99
R2113:Rims2	UTSW	15	39511326	missense	probably benign	0.17
R2260:Rims2	UTSW	15	39478566	nonsense	probably null
R2510:Rims2	UTSW	15	39585652	missense	probably damaging	1.00
R3693:Rims2	UTSW	15	39478575	missense	probably benign	0.01
R3937:Rims2	UTSW	15	39437845	missense	probably damaging	1.00
R4425:Rims2	UTSW	15	39437924	critical splice donor site	probably null
R4453:Rims2	UTSW	15	39292208	missense	probably damaging	1.00
R4474:Rims2	UTSW	15	39462560	missense	probably damaging	1.00
R4518:Rims2	UTSW	15	39437526	missense	probably damaging	1.00
R4526:Rims2	UTSW	15	39437717	missense	probably damaging	1.00
R4833:Rims2	UTSW	15	39535914	missense	probably damaging	0.98
R4936:Rims2	UTSW	15	39437728	missense	probably damaging	1.00
R4993:Rims2	UTSW	15	39454445	missense	possibly damaging	0.90
R5001:Rims2	UTSW	15	39452428	missense	probably benign	0.03
R5054:Rims2	UTSW	15	39517869	splice site	probably null
R5072:Rims2	UTSW	15	39462590	missense	probably benign	0.01
R5171:Rims2	UTSW	15	39437103	missense	probably damaging	1.00
R5429:Rims2	UTSW	15	39345355	missense	probably damaging	1.00
R5623:Rims2	UTSW	15	39478615	missense	probably damaging	1.00
R5624:Rims2	UTSW	15	39345413	missense	possibly damaging	0.46
R5685:Rims2	UTSW	15	39437206	missense	possibly damaging	0.67
R5784:Rims2	UTSW	15	39535987	splice site	probably null
R5790:Rims2	UTSW	15	39681045	missense	probably damaging	1.00
R5822:Rims2	UTSW	15	39476490	missense	probably damaging	1.00
R5963:Rims2	UTSW	15	39437182	missense	probably damaging	1.00
R5988:Rims2	UTSW	15	39292182	missense	probably damaging	1.00
R6057:Rims2	UTSW	15	39675020	missense	probably damaging	1.00
R6239:Rims2	UTSW	15	39198363	start codon destroyed	unknown
R6407:Rims2	UTSW	15	39452328	missense	probably damaging	1.00
R6418:Rims2	UTSW	15	39509696	missense	probably damaging	1.00
R6495:Rims2	UTSW	15	39517812	missense	probably benign	0.01
R6502:Rims2	UTSW	15	39534855	missense	probably benign	0.42
R6753:Rims2	UTSW	15	39566973	missense	possibly damaging	0.74
R6855:Rims2	UTSW	15	39345515	missense	probably benign	0.06
R6948:Rims2	UTSW	15	39511341	missense	probably benign
R7058:Rims2	UTSW	15	39585648	missense	probably damaging	1.00
R7167:Rims2	UTSW	15	39437077	missense	probably benign
R7217:Rims2	UTSW	15	39476489	missense	probably damaging	0.99
R7223:Rims2	UTSW	15	39437032	missense	probably benign	0.30
R7289:Rims2	UTSW	15	39437718	missense	probably benign	0.00
R7459:Rims2	UTSW	15	39517839	missense	probably benign
R7663:Rims2	UTSW	15	39507026	missense	probably damaging	1.00
R7792:Rims2	UTSW	15	39198528	missense	possibly damaging	0.69
R7836:Rims2	UTSW	15	39681079	missense	probably damaging	1.00
R8082:Rims2	UTSW	15	39476523	missense	probably benign	0.34
R8489:Rims2	UTSW	15	39616450	missense	probably damaging	1.00
R8730:Rims2	UTSW	15	39517843	missense	probably benign	0.01
R8830:Rims2	UTSW	15	39437362	missense	possibly damaging	0.64
R8857:Rims2	UTSW	15	39679648	missense	possibly damaging	0.95
R8893:Rims2	UTSW	15	39534954	missense	probably benign	0.02
R9010:Rims2	UTSW	15	39452390	nonsense	probably null
R9030:Rims2	UTSW	15	39476477	missense	probably damaging	1.00
R9287:Rims2	UTSW	15	39679690	missense	probably damaging	1.00
R9395:Rims2	UTSW	15	39292269	missense	probably damaging	1.00
R9451:Rims2	UTSW	15	39437328	missense	probably damaging	1.00
R9506:Rims2	UTSW	15	39472436	missense	probably damaging	0.97
X0034:Rims2	UTSW	15	39437534	missense	probably benign
Z1177:Rims2	UTSW	15	39437769	missense	probably benign	0.24
Z1177:Rims2	UTSW	15	39478690	frame shift	probably null
Z1177:Rims2	UTSW	15	39681114	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACTAGGTGTGGCCCATCAGTG -3'
(R):5'- AGCCCAGCAGTCCTAGCTTCTC -3'

Sequencing Primer
(F):5'- TTCTATCTGTAAGAAAAGCCAGACC -3'
(R):5'- TTAGCCATGAACCTCTGGTG -3'

Posted On

2014-03-14