Mutagenetix > Incidental Mutation

Incidental Mutation 'R1457:Son'

158611

Institutional Source

Beutler Lab

Gene Symbol

Son

Ensembl Gene

ENSMUSG00000022961

Gene Name

Son DNA binding protein

Synonyms

2900011L12Rik

MMRRC Submission

039512-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.955) question?

Stock #

R1457 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

91647506-91679221 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 91657086 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 907 (D907G)

Ref Sequence

ENSEMBL: ENSMUSP00000122320 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114036] [ENSMUST00000114037] [ENSMUST00000117633] [ENSMUST00000119368] [ENSMUST00000122302] [ENSMUST00000140312]

AlphaFold

Q9QX47

Predicted Effect

probably damaging
Transcript: ENSMUST00000114036
AA Change: D907G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000109670
Gene: ENSMUSG00000022961
AA Change: D907G

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	1.65e-7	PROSPERO
internal_repeat_2	214	362	6.55e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	1.65e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	6.55e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114037
AA Change: D907G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000109671
Gene: ENSMUSG00000022961
AA Change: D907G

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	1.71e-7	PROSPERO
internal_repeat_2	214	362	7.05e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	1.71e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	7.05e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC
low complexity region	2149	2155	N/A	INTRINSIC
G_patch	2321	2367	1.15e-17	SMART
Pfam:DND1_DSRM	2388	2442	5.7e-15	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000117633
AA Change: D907G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000112453
Gene: ENSMUSG00000022961
AA Change: D907G

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	1.59e-7	PROSPERO
internal_repeat_2	214	362	6.63e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	1.59e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	6.63e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
Pfam:RSRP	1909	2216	1e-12	PFAM
G_patch	2321	2367	1.15e-17	SMART
DSRM	2390	2458	5.37e-20	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000119368
AA Change: D907G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113129
Gene: ENSMUSG00000022961
AA Change: D907G

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	2.22e-7	PROSPERO
internal_repeat_2	214	362	8.67e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	2.22e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	8.67e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC
low complexity region	2149	2155	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000122302

SMART Domains

Protein: ENSMUSP00000113615
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
low complexity region	90	101	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
low complexity region	159	165	N/A	INTRINSIC
G_patch	331	377	1.15e-17	SMART
Pfam:DND1_DSRM	398	452	7.9e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000140312
AA Change: D907G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000122320
Gene: ENSMUSG00000022961
AA Change: D907G

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	2.93e-7	PROSPERO
internal_repeat_2	214	362	1.1e-5	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	2.93e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	1.1e-5	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC
low complexity region	2149	2155	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147891

SMART Domains

Protein: ENSMUSP00000122544
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
Pfam:RSRP	61	358	2.9e-13	PFAM
low complexity region	466	477	N/A	INTRINSIC

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.7%
20x: 87.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains multiple simple repeats. The encoded protein binds RNA and promotes pre-mRNA splicing, particularly of transcripts with poor splice sites. The protein also recognizes a specific DNA sequence found in the human hepatitis B virus (HBV) and represses HBV core promoter activity. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	A	T	1: 37,626,012	Y268*	probably null	Het
Abca14	A	T	7: 120,289,460	I1210F	probably benign	Het
Ankrd17	T	C	5: 90,285,846	H688R	possibly damaging	Het
Arhgap24	T	A	5: 102,664,106	N66K	probably damaging	Het
Atp1a1	C	T	3: 101,590,466	G335D	probably damaging	Het
Cacna1g	C	T	11: 94,459,555	R488H	possibly damaging	Het
Cacna1h	A	T	17: 25,397,620	V149E	probably damaging	Het
Cd22	G	T	7: 30,873,170	P338Q	probably benign	Het
Cntln	G	T	4: 85,096,839	M1122I	probably benign	Het
Cntrl	A	G	2: 35,122,756	N302S	probably benign	Het
Cog8	T	C	8: 107,052,896	R250G	probably damaging	Het
Creld2	T	C	15: 88,823,753	C232R	probably damaging	Het
Cyp2b23	G	A	7: 26,673,149	P347L	probably damaging	Het
Dnah5	T	C	15: 28,403,542		probably null	Het
Eml6	C	T	11: 30,024,459	V40I	probably damaging	Het
Epb42	C	T	2: 121,029,967		probably null	Het
Fcrla	A	G	1: 170,921,004	L190P	probably damaging	Het
Galnt18	A	T	7: 111,779,428	Y40*	probably null	Het
Gdf7	A	T	12: 8,298,073	M416K	probably damaging	Het
Gm11232	T	A	4: 71,756,919		probably null	Het
Gpam	T	A	19: 55,088,176	N198Y	probably damaging	Het
Grip1	C	T	10: 119,986,350	S327F	possibly damaging	Het
Hey2	C	T	10: 30,834,356	A134T	probably benign	Het
Kat6a	T	C	8: 22,938,652	I1341T	probably benign	Het
Kcnd3	T	C	3: 105,668,186	L542P	probably benign	Het
Lars	G	A	18: 42,210,050	R1101C	probably damaging	Het
Lman2	T	C	13: 55,351,251	D234G	probably benign	Het
Map3k19	A	C	1: 127,817,898	I1273R	probably damaging	Het
Matn1	T	A	4: 130,950,019	F180I	possibly damaging	Het
Meikin	T	A	11: 54,370,941	L61*	probably null	Het
Mroh2b	G	T	15: 4,925,684	D720Y	probably damaging	Het
Myh13	T	C	11: 67,331,046	I199T	probably damaging	Het
Myh4	T	A	11: 67,248,461	S535T	probably damaging	Het
Myo5a	T	C	9: 75,213,065	M1715T	probably damaging	Het
Nat8	A	T	6: 85,830,989	V54D	probably damaging	Het
Nbea	A	G	3: 56,085,327	V286A	probably damaging	Het
Ndnf	A	G	6: 65,704,014	K426E	possibly damaging	Het
Nup210l	T	A	3: 90,190,972	N1410K	possibly damaging	Het
Oca2	A	T	7: 56,321,521	T399S	probably damaging	Het
Olfr1045	A	G	2: 86,198,252	S167P	probably damaging	Het
Olfr118	A	T	17: 37,672,925	K301*	probably null	Het
Olfr250	G	A	9: 38,368,196	V217I	probably benign	Het
Olfr366	A	C	2: 37,219,659	T57P	possibly damaging	Het
Olfr644	A	T	7: 104,068,459	C191S	probably damaging	Het
Olfr652	T	A	7: 104,565,071	N283K	probably damaging	Het
Otogl	A	C	10: 107,878,152		probably null	Het
Pde4b	C	T	4: 102,605,176	T511I	probably damaging	Het
Proser3	A	G	7: 30,539,747		probably null	Het
Psmd12	G	A	11: 107,479,646	V24M	probably damaging	Het
Rbm17	A	T	2: 11,593,461	M170K	probably benign	Het
Rims2	C	T	15: 39,511,314	T1064I	possibly damaging	Het
Ripor3	C	T	2: 167,992,653	V281M	probably damaging	Het
Rreb1	C	A	13: 37,946,928	Q1353K	possibly damaging	Het
Sgo2a	A	G	1: 58,015,806	D383G	probably benign	Het
Sik3	C	T	9: 46,221,148	T1346M	probably damaging	Het
Slx1b	A	T	7: 126,692,796	V63E	probably damaging	Het
Src	G	A	2: 157,469,212	V401M	probably damaging	Het
St3gal4	T	C	9: 35,054,757	K24E	possibly damaging	Het
Stat6	A	G	10: 127,658,245	K647R	probably damaging	Het
Tbl1xr1	G	A	3: 22,193,169		probably null	Het
Tlk2	G	A	11: 105,256,952		probably null	Het
Tmbim6	T	A	15: 99,401,615	I3K	probably benign	Het
Tmeff2	A	T	1: 51,181,867	I334F	probably damaging	Het
Ttn	T	C	2: 76,840,315		probably null	Het
Ubl7	T	A	9: 57,914,611	I81N	probably damaging	Het
Ugt1a10	A	G	1: 88,055,711	Y77C	probably damaging	Het
Uqcrfs1	A	G	13: 30,540,907	C217R	probably damaging	Het
Usp50	T	C	2: 126,761,634	T331A	probably benign	Het
Vmn1r65	A	G	7: 6,009,157	V26A	probably benign	Het
Wdfy3	A	C	5: 101,917,579	V1241G	possibly damaging	Het
Wtap	A	C	17: 12,981,744		probably null	Het
Zbtb40	C	A	4: 136,984,837	A1187S	possibly damaging	Het
Zfp57	T	C	17: 37,006,098	S20P	probably damaging	Het
Zfp592	A	G	7: 81,024,479	D397G	probably damaging	Het
Zfp747	A	T	7: 127,374,504	S165T	probably benign	Het
Zfp949	C	T	9: 88,569,838	T487I	probably damaging	Het
Zscan4d	A	G	7: 11,164,994	C119R	probably damaging	Het

Other mutations in Son

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00531:Son	APN	16	91664322	missense	probably damaging	0.99
IGL01024:Son	APN	16	91655910	missense	probably damaging	1.00
IGL01066:Son	APN	16	91660136	intron	probably benign
IGL01083:Son	APN	16	91657391	missense	probably damaging	1.00
IGL01115:Son	APN	16	91659458	missense	probably benign	0.31
IGL01467:Son	APN	16	91657277	missense	possibly damaging	0.93
IGL01506:Son	APN	16	91657286	missense	possibly damaging	0.67
IGL01933:Son	APN	16	91658015	missense	probably benign	0.00
IGL02156:Son	APN	16	91656104	missense	possibly damaging	0.93
IGL02473:Son	APN	16	91658795	missense	probably damaging	0.99
IGL02498:Son	APN	16	91656825	missense	probably damaging	0.99
IGL02517:Son	APN	16	91655211	missense	possibly damaging	0.92
IGL02530:Son	APN	16	91658471	missense	possibly damaging	0.50
IGL02865:Son	APN	16	91651752	missense	probably damaging	1.00
IGL03180:Son	APN	16	91657008	missense	probably damaging	1.00
R0013:Son	UTSW	16	91651662	missense	probably damaging	1.00
R0036:Son	UTSW	16	91660166	intron	probably benign
R0037:Son	UTSW	16	91664728	missense	probably damaging	1.00
R0041:Son	UTSW	16	91659333	missense	probably damaging	1.00
R0048:Son	UTSW	16	91658977	missense	possibly damaging	0.94
R0048:Son	UTSW	16	91658977	missense	possibly damaging	0.94
R0056:Son	UTSW	16	91678155	missense	possibly damaging	0.86
R0227:Son	UTSW	16	91656873	missense	probably damaging	0.99
R0256:Son	UTSW	16	91656584	missense	possibly damaging	0.95
R0302:Son	UTSW	16	91656144	missense	probably damaging	1.00
R0815:Son	UTSW	16	91655484	missense	probably damaging	0.98
R1225:Son	UTSW	16	91657340	missense	probably damaging	1.00
R1255:Son	UTSW	16	91664695	missense	probably damaging	1.00
R1459:Son	UTSW	16	91655342	missense	possibly damaging	0.93
R1535:Son	UTSW	16	91659734	missense	probably damaging	0.99
R1587:Son	UTSW	16	91659718	missense	probably damaging	1.00
R1605:Son	UTSW	16	91657664	missense	probably damaging	1.00
R1629:Son	UTSW	16	91657622	missense	probably damaging	1.00
R1711:Son	UTSW	16	91660226	intron	probably benign
R2138:Son	UTSW	16	91659372	missense	possibly damaging	0.95
R2245:Son	UTSW	16	91647960	splice site	probably null
R2351:Son	UTSW	16	91657659	missense	probably damaging	0.98
R2434:Son	UTSW	16	91654687	missense	probably damaging	1.00
R2870:Son	UTSW	16	91664317	splice site	probably null
R2871:Son	UTSW	16	91664317	splice site	probably null
R2872:Son	UTSW	16	91664317	splice site	probably null
R2889:Son	UTSW	16	91659899	unclassified	probably benign
R3712:Son	UTSW	16	91656726	missense	probably damaging	0.99
R3913:Son	UTSW	16	91660111	intron	probably benign
R4172:Son	UTSW	16	91659362	missense	probably damaging	1.00
R4301:Son	UTSW	16	91658411	missense	possibly damaging	0.53
R4302:Son	UTSW	16	91658411	missense	possibly damaging	0.53
R4770:Son	UTSW	16	91658868	missense	probably damaging	0.96
R4881:Son	UTSW	16	91675509	missense	probably benign	0.31
R5020:Son	UTSW	16	91656375	missense	probably damaging	1.00
R5032:Son	UTSW	16	91657664	missense	probably damaging	1.00
R5151:Son	UTSW	16	91655699	missense	probably damaging	1.00
R5153:Son	UTSW	16	91655022	missense	possibly damaging	0.86
R5215:Son	UTSW	16	91656675	missense	probably damaging	0.99
R5243:Son	UTSW	16	91654733	missense	probably damaging	1.00
R5354:Son	UTSW	16	91655739	missense	probably damaging	0.99
R5529:Son	UTSW	16	91655466	missense	probably damaging	1.00
R5696:Son	UTSW	16	91671413	missense	possibly damaging	0.67
R5763:Son	UTSW	16	91657490	missense	probably damaging	1.00
R5766:Son	UTSW	16	91664987	intron	probably benign
R5788:Son	UTSW	16	91660052	intron	probably benign
R5992:Son	UTSW	16	91658904	missense	probably benign	0.04
R6314:Son	UTSW	16	91660410	intron	probably benign
R6371:Son	UTSW	16	91674741
R6429:Son	UTSW	16	91658166	missense	probably benign	0.33
R6451:Son	UTSW	16	91657602	missense	probably damaging	0.99
R6489:Son	UTSW	16	91655156	missense	possibly damaging	0.70
R6513:Son	UTSW	16	91659947	intron	probably benign
R6753:Son	UTSW	16	91657188	missense	probably damaging	0.99
R6916:Son	UTSW	16	91654785	missense	probably damaging	0.97
R7070:Son	UTSW	16	91656841	unclassified	probably benign
R7079:Son	UTSW	16	91656841	unclassified	probably benign
R7110:Son	UTSW	16	91656518	missense	probably benign	0.01
R7120:Son	UTSW	16	91656691	unclassified	probably benign
R7120:Son	UTSW	16	91670526	missense	unknown
R7167:Son	UTSW	16	91660334	small deletion	probably benign
R7205:Son	UTSW	16	91660295	small deletion	probably benign
R7208:Son	UTSW	16	91662102	missense	unknown
R7219:Son	UTSW	16	91665001	missense	unknown
R7249:Son	UTSW	16	91660334	small deletion	probably benign
R7328:Son	UTSW	16	91658390	missense	probably benign	0.33
R7330:Son	UTSW	16	91656598	unclassified	probably benign
R7374:Son	UTSW	16	91660334	small deletion	probably benign
R7405:Son	UTSW	16	91656691	unclassified	probably benign
R7420:Son	UTSW	16	91660334	small deletion	probably benign
R7424:Son	UTSW	16	91660334	small deletion	probably benign
R7464:Son	UTSW	16	91656691	unclassified	probably benign
R7514:Son	UTSW	16	91654860	missense	probably damaging	0.99
R7555:Son	UTSW	16	91658922	missense	probably damaging	0.99
R7645:Son	UTSW	16	91660295	small deletion	probably benign
R7716:Son	UTSW	16	91656691	unclassified	probably benign
R7718:Son	UTSW	16	91660334	small deletion	probably benign
R7778:Son	UTSW	16	91656528	missense	probably damaging	0.99
R7824:Son	UTSW	16	91656528	missense	probably damaging	0.99
R7856:Son	UTSW	16	91659258	missense	probably damaging	0.99
R7870:Son	UTSW	16	91656598	unclassified	probably benign
R7928:Son	UTSW	16	91656841	unclassified	probably benign
R7972:Son	UTSW	16	91660334	small deletion	probably benign
R7978:Son	UTSW	16	91660334	small deletion	probably benign
R8000:Son	UTSW	16	91660334	small deletion	probably benign
R8192:Son	UTSW	16	91655549	missense	possibly damaging	0.91
R8221:Son	UTSW	16	91656846	missense	probably damaging	1.00
R8227:Son	UTSW	16	91656691	unclassified	probably benign
R8233:Son	UTSW	16	91660334	small deletion	probably benign
R8255:Son	UTSW	16	91664936	missense	unknown
R8292:Son	UTSW	16	91656657	missense	possibly damaging	0.93
R8407:Son	UTSW	16	91660334	small deletion	probably benign
R8468:Son	UTSW	16	91656691	unclassified	probably benign
R8495:Son	UTSW	16	91660295	small deletion	probably benign
R8772:Son	UTSW	16	91657938	missense	possibly damaging	0.65
R8796:Son	UTSW	16	91660334	small deletion	probably benign
R8862:Son	UTSW	16	91656846	missense	probably damaging	1.00
R8962:Son	UTSW	16	91658169	missense	possibly damaging	0.91
R8972:Son	UTSW	16	91660334	small deletion	probably benign
R8991:Son	UTSW	16	91656478	missense	probably benign	0.04
R8991:Son	UTSW	16	91656720	missense	possibly damaging	0.95
R9086:Son	UTSW	16	91670530	missense	unknown
R9138:Son	UTSW	16	91655118	missense	possibly damaging	0.80
R9232:Son	UTSW	16	91656691	unclassified	probably benign
R9241:Son	UTSW	16	91657234	missense	probably damaging	0.96
R9258:Son	UTSW	16	91677682	missense	unknown
R9328:Son	UTSW	16	91655757	missense	possibly damaging	0.67
R9420:Son	UTSW	16	91657620	missense	probably damaging	0.98
R9468:Son	UTSW	16	91657551	missense	possibly damaging	0.53
R9500:Son	UTSW	16	91660334	small deletion	probably benign
R9516:Son	UTSW	16	91656691	unclassified	probably benign
R9595:Son	UTSW	16	91657353	missense	possibly damaging	0.73
R9679:Son	UTSW	16	91660334	small deletion	probably benign
R9719:Son	UTSW	16	91659552	missense	probably damaging	0.96
R9749:Son	UTSW	16	91656691	unclassified	probably benign
R9772:Son	UTSW	16	91660334	small deletion	probably benign
R9782:Son	UTSW	16	91647950	missense	probably damaging	0.99
R9788:Son	UTSW	16	91656811	unclassified	probably benign
RF007:Son	UTSW	16	91659369	missense	possibly damaging	0.53
RF041:Son	UTSW	16	91656691	unclassified	probably benign
Z1176:Son	UTSW	16	91655801	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- GGACCCCTTGATGGCCCAAGA -3'
(R):5'- TGCAGCATAGGACATCATCATAGAACG -3'

Sequencing Primer
(F):5'- CCAGATGTTAGCAACCAGCA -3'
(R):5'- CATCAAGGGTCTAGGTGCTAACC -3'

Posted On

2014-03-14