Mutagenetix > Incidental Mutation

Incidental Mutation 'R1457:Gpam'

158617

Institutional Source

Beutler Lab

Gene Symbol

Gpam

Ensembl Gene

ENSMUSG00000024978

Gene Name

glycerol-3-phosphate acyltransferase, mitochondrial

Synonyms

GPAT1

MMRRC Submission

039512-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.160) question?

Stock #

R1457 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55069734-55099451 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 55088176 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 198 (N198Y)

Ref Sequence

ENSEMBL: ENSMUSP00000057635 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061856]

AlphaFold

Q61586

Predicted Effect

probably damaging
Transcript: ENSMUST00000061856
AA Change: N198Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000057635
Gene: ENSMUSG00000024978
AA Change: N198Y

Domain	Start	End	E-Value	Type
Blast:PlsC	5	34	3e-8	BLAST
PlsC	224	357	2.46e-23	SMART
Blast:PlsC	499	551	8e-27	BLAST
low complexity region	687	699	N/A	INTRINSIC

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.7%
20x: 87.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial enzyme which prefers saturated fatty acids as its substrate for the synthesis of glycerolipids. This metabolic pathway's first step is catalyzed by the encoded enzyme. Two forms for this enzyme exist, one in the mitochondria and one in the endoplasmic reticulum. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutant mice weighed less than controls and showed reduced triacylglycerol levels in the liver and plasma. The glycerolipid fatty acid composition is also disrupted in mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	A	T	1: 37,626,012	Y268*	probably null	Het
Abca14	A	T	7: 120,289,460	I1210F	probably benign	Het
Ankrd17	T	C	5: 90,285,846	H688R	possibly damaging	Het
Arhgap24	T	A	5: 102,664,106	N66K	probably damaging	Het
Atp1a1	C	T	3: 101,590,466	G335D	probably damaging	Het
Cacna1g	C	T	11: 94,459,555	R488H	possibly damaging	Het
Cacna1h	A	T	17: 25,397,620	V149E	probably damaging	Het
Cd22	G	T	7: 30,873,170	P338Q	probably benign	Het
Cntln	G	T	4: 85,096,839	M1122I	probably benign	Het
Cntrl	A	G	2: 35,122,756	N302S	probably benign	Het
Cog8	T	C	8: 107,052,896	R250G	probably damaging	Het
Creld2	T	C	15: 88,823,753	C232R	probably damaging	Het
Cyp2b23	G	A	7: 26,673,149	P347L	probably damaging	Het
Dnah5	T	C	15: 28,403,542		probably null	Het
Eml6	C	T	11: 30,024,459	V40I	probably damaging	Het
Epb42	C	T	2: 121,029,967		probably null	Het
Fcrla	A	G	1: 170,921,004	L190P	probably damaging	Het
Galnt18	A	T	7: 111,779,428	Y40*	probably null	Het
Gdf7	A	T	12: 8,298,073	M416K	probably damaging	Het
Gm11232	T	A	4: 71,756,919		probably null	Het
Grip1	C	T	10: 119,986,350	S327F	possibly damaging	Het
Hey2	C	T	10: 30,834,356	A134T	probably benign	Het
Kat6a	T	C	8: 22,938,652	I1341T	probably benign	Het
Kcnd3	T	C	3: 105,668,186	L542P	probably benign	Het
Lars	G	A	18: 42,210,050	R1101C	probably damaging	Het
Lman2	T	C	13: 55,351,251	D234G	probably benign	Het
Map3k19	A	C	1: 127,817,898	I1273R	probably damaging	Het
Matn1	T	A	4: 130,950,019	F180I	possibly damaging	Het
Meikin	T	A	11: 54,370,941	L61*	probably null	Het
Mroh2b	G	T	15: 4,925,684	D720Y	probably damaging	Het
Myh13	T	C	11: 67,331,046	I199T	probably damaging	Het
Myh4	T	A	11: 67,248,461	S535T	probably damaging	Het
Myo5a	T	C	9: 75,213,065	M1715T	probably damaging	Het
Nat8	A	T	6: 85,830,989	V54D	probably damaging	Het
Nbea	A	G	3: 56,085,327	V286A	probably damaging	Het
Ndnf	A	G	6: 65,704,014	K426E	possibly damaging	Het
Nup210l	T	A	3: 90,190,972	N1410K	possibly damaging	Het
Oca2	A	T	7: 56,321,521	T399S	probably damaging	Het
Olfr1045	A	G	2: 86,198,252	S167P	probably damaging	Het
Olfr118	A	T	17: 37,672,925	K301*	probably null	Het
Olfr250	G	A	9: 38,368,196	V217I	probably benign	Het
Olfr366	A	C	2: 37,219,659	T57P	possibly damaging	Het
Olfr644	A	T	7: 104,068,459	C191S	probably damaging	Het
Olfr652	T	A	7: 104,565,071	N283K	probably damaging	Het
Otogl	A	C	10: 107,878,152		probably null	Het
Pde4b	C	T	4: 102,605,176	T511I	probably damaging	Het
Proser3	A	G	7: 30,539,747		probably null	Het
Psmd12	G	A	11: 107,479,646	V24M	probably damaging	Het
Rbm17	A	T	2: 11,593,461	M170K	probably benign	Het
Rims2	C	T	15: 39,511,314	T1064I	possibly damaging	Het
Ripor3	C	T	2: 167,992,653	V281M	probably damaging	Het
Rreb1	C	A	13: 37,946,928	Q1353K	possibly damaging	Het
Sgo2a	A	G	1: 58,015,806	D383G	probably benign	Het
Sik3	C	T	9: 46,221,148	T1346M	probably damaging	Het
Slx1b	A	T	7: 126,692,796	V63E	probably damaging	Het
Son	A	G	16: 91,657,086	D907G	probably damaging	Het
Src	G	A	2: 157,469,212	V401M	probably damaging	Het
St3gal4	T	C	9: 35,054,757	K24E	possibly damaging	Het
Stat6	A	G	10: 127,658,245	K647R	probably damaging	Het
Tbl1xr1	G	A	3: 22,193,169		probably null	Het
Tlk2	G	A	11: 105,256,952		probably null	Het
Tmbim6	T	A	15: 99,401,615	I3K	probably benign	Het
Tmeff2	A	T	1: 51,181,867	I334F	probably damaging	Het
Ttn	T	C	2: 76,840,315		probably null	Het
Ubl7	T	A	9: 57,914,611	I81N	probably damaging	Het
Ugt1a10	A	G	1: 88,055,711	Y77C	probably damaging	Het
Uqcrfs1	A	G	13: 30,540,907	C217R	probably damaging	Het
Usp50	T	C	2: 126,761,634	T331A	probably benign	Het
Vmn1r65	A	G	7: 6,009,157	V26A	probably benign	Het
Wdfy3	A	C	5: 101,917,579	V1241G	possibly damaging	Het
Wtap	A	C	17: 12,981,744		probably null	Het
Zbtb40	C	A	4: 136,984,837	A1187S	possibly damaging	Het
Zfp57	T	C	17: 37,006,098	S20P	probably damaging	Het
Zfp592	A	G	7: 81,024,479	D397G	probably damaging	Het
Zfp747	A	T	7: 127,374,504	S165T	probably benign	Het
Zfp949	C	T	9: 88,569,838	T487I	probably damaging	Het
Zscan4d	A	G	7: 11,164,994	C119R	probably damaging	Het

Other mutations in Gpam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Gpam	APN	19	55078332	missense	possibly damaging	0.71
IGL01349:Gpam	APN	19	55096119	critical splice donor site	probably null
IGL01515:Gpam	APN	19	55087451	missense	probably damaging	1.00
IGL01650:Gpam	APN	19	55081700	missense	probably benign	0.02
IGL01768:Gpam	APN	19	55087520	missense	probably benign	0.00
IGL01809:Gpam	APN	19	55075625	nonsense	probably null
IGL01878:Gpam	APN	19	55083374	missense	probably benign	0.22
IGL02451:Gpam	APN	19	55088203	missense	probably damaging	1.00
IGL03293:Gpam	APN	19	55071016	missense	probably benign
IGL03391:Gpam	APN	19	55081696	missense	probably damaging	1.00
R0492:Gpam	UTSW	19	55096179	missense	possibly damaging	0.72
R0703:Gpam	UTSW	19	55072756	missense	probably benign	0.00
R1083:Gpam	UTSW	19	55088211	splice site	probably benign
R1432:Gpam	UTSW	19	55079261	missense	probably damaging	0.99
R1556:Gpam	UTSW	19	55076331	missense	possibly damaging	0.94
R1733:Gpam	UTSW	19	55081469	missense	probably damaging	0.99
R1744:Gpam	UTSW	19	55074591	missense	probably damaging	1.00
R1776:Gpam	UTSW	19	55078575	missense	possibly damaging	0.88
R2267:Gpam	UTSW	19	55072710	critical splice donor site	probably null
R2697:Gpam	UTSW	19	55083209	missense	probably damaging	1.00
R3836:Gpam	UTSW	19	55080458	missense	probably benign
R3837:Gpam	UTSW	19	55080458	missense	probably benign
R3838:Gpam	UTSW	19	55080458	missense	probably benign
R3839:Gpam	UTSW	19	55080458	missense	probably benign
R4670:Gpam	UTSW	19	55096119	critical splice donor site	probably null
R4717:Gpam	UTSW	19	55075614	missense	probably benign	0.00
R4819:Gpam	UTSW	19	55078341	missense	probably benign	0.03
R5104:Gpam	UTSW	19	55093986	missense	probably benign	0.44
R5146:Gpam	UTSW	19	55093946	missense	probably damaging	1.00
R5183:Gpam	UTSW	19	55083227	missense	probably damaging	1.00
R5326:Gpam	UTSW	19	55091165	missense	probably benign	0.05
R5347:Gpam	UTSW	19	55088837	missense	probably damaging	1.00
R5621:Gpam	UTSW	19	55079260	missense	probably damaging	1.00
R5644:Gpam	UTSW	19	55088899	missense	probably benign	0.00
R6244:Gpam	UTSW	19	55070985	missense	probably damaging	1.00
R6260:Gpam	UTSW	19	55083406	missense	probably benign	0.40
R6965:Gpam	UTSW	19	55074609	missense	probably damaging	1.00
R7125:Gpam	UTSW	19	55076335	missense	probably benign
R7567:Gpam	UTSW	19	55081630	missense	possibly damaging	0.86
R7715:Gpam	UTSW	19	55088921	missense	probably benign	0.19
R7719:Gpam	UTSW	19	55081670	missense	probably damaging	1.00
R7863:Gpam	UTSW	19	55070956	missense	probably damaging	1.00
R8187:Gpam	UTSW	19	55077837	missense	probably benign
R8434:Gpam	UTSW	19	55081631	missense	possibly damaging	0.93
R8483:Gpam	UTSW	19	55088942	missense	probably damaging	0.99
R8510:Gpam	UTSW	19	55080382	critical splice donor site	probably null
R8537:Gpam	UTSW	19	55096239	missense	probably benign	0.02
R8841:Gpam	UTSW	19	55078518	missense	probably damaging	1.00
R8915:Gpam	UTSW	19	55088880	missense	probably benign
R8987:Gpam	UTSW	19	55083795	missense	possibly damaging	0.79
R9224:Gpam	UTSW	19	55087475	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACTCTGAACAAGCTCCAGCAGTG -3'
(R):5'- AGCCAGCAGAGACTTCTGTGAGTG -3'

Sequencing Primer
(F):5'- GACAGGGAACAGAAATCCTACC -3'
(R):5'- TCAGTTCAGATAACCAGGTGC -3'

Posted On

2014-03-14