Incidental Mutation 'R1443:Myo3a'
ID 158623
Institutional Source Beutler Lab
Gene Symbol Myo3a
Ensembl Gene ENSMUSG00000025716
Gene Name myosin IIIA
Synonyms 9030416P08Rik
MMRRC Submission 039498-MU
Accession Numbers

Genbank: NM_148413; MGI: 2183924
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1443 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 22227503-22618252 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 22282626 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 191 (N191I)
Ref Sequence ENSEMBL: ENSMUSP00000046329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000153002]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000044749
AA Change: N191I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716
AA Change: N191I

DomainStartEndE-ValueType
S_TKc 29 295 1.62e-91 SMART
MYSc 340 1061 2.07e-252 SMART
IQ 1061 1083 2.88e1 SMART
IQ 1088 1110 9.48e-3 SMART
low complexity region 1153 1169 N/A INTRINSIC
low complexity region 1359 1369 N/A INTRINSIC
low complexity region 1496 1505 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142435
Predicted Effect possibly damaging
Transcript: ENSMUST00000153002
AA Change: N183I

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120573
Gene: ENSMUSG00000025716
AA Change: N183I

DomainStartEndE-ValueType
S_TKc 21 287 1.62e-91 SMART
MYSc 332 753 3.06e-35 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 85.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,262,798 S56R probably damaging Het
Actr8 A G 14: 29,984,099 M99V possibly damaging Het
Adamtsl2 T A 2: 27,103,066 C703S possibly damaging Het
Afap1 G T 5: 35,968,661 K333N probably damaging Het
Aldh3a2 G A 11: 61,264,307 S137L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aoc1 A T 6: 48,905,445 K107M possibly damaging Het
Bmp8a G T 4: 123,316,965 S252R possibly damaging Het
C7 T C 15: 5,059,419 I13M probably benign Het
Cblb T A 16: 52,139,611 D322E possibly damaging Het
Cfap54 G A 10: 92,932,721 T180I probably damaging Het
Clrn2 C T 5: 45,460,111 A108V probably damaging Het
Cspg4 T A 9: 56,886,512 D510E probably damaging Het
Cyp2c40 A T 19: 39,777,971 N393K possibly damaging Het
Dcaf5 T C 12: 80,364,069 Y294C probably damaging Het
Dclk3 T A 9: 111,469,020 M544K probably benign Het
Doxl2 A T 6: 48,975,915 Y258F probably damaging Het
Ell3 A T 2: 121,439,465 F388I probably damaging Het
Fam208b T C 13: 3,575,543 K1469R probably benign Het
Fam78b A G 1: 167,078,760 I163V probably damaging Het
Gnptab T C 10: 88,434,081 L882P probably damaging Het
Herc2 A T 7: 56,204,733 D3802V possibly damaging Het
Hs3st5 A G 10: 36,833,414 E315G probably benign Het
Idh3b A T 2: 130,284,054 probably null Het
Lama4 G A 10: 39,073,643 E911K probably damaging Het
Macf1 A G 4: 123,511,007 I436T probably damaging Het
Mgam C A 6: 40,759,780 S871* probably null Het
Mtmr7 A G 8: 40,560,882 S212P probably damaging Het
Mylk2 A G 2: 152,919,416 T480A probably damaging Het
Nanog C T 6: 122,711,775 S105F probably damaging Het
Nanos2 A G 7: 18,987,639 Y12C probably damaging Het
Nsg1 C T 5: 38,155,643 V71I probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr1458 G T 19: 13,103,204 Y33* probably null Het
Olfr1512 A T 14: 52,372,951 I34N probably damaging Het
Olfr211 T C 6: 116,494,425 L272S probably benign Het
Olfr643 A T 7: 104,058,723 I293N probably damaging Het
Pcdhb17 A G 18: 37,486,648 Q497R probably benign Het
Pcsk7 C A 9: 45,925,986 P536Q probably damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Phyhip A G 14: 70,467,291 K317E probably damaging Het
Pkhd1 C T 1: 20,534,558 G1178R probably damaging Het
Ppp1r9a G A 6: 5,057,557 G544D probably damaging Het
Ptpn3 T C 4: 57,225,775 D480G probably benign Het
Ptprn2 A T 12: 117,253,615 K918N probably damaging Het
Rab42 T C 4: 132,302,347 D188G probably benign Het
Rasgrf2 C A 13: 91,983,676 D20Y probably damaging Het
Ryr2 G A 13: 11,779,266 T942I probably benign Het
Sbpl T C 17: 23,953,354 K197R unknown Het
Slc44a1 T A 4: 53,561,069 V595E probably damaging Het
Slc6a19 A G 13: 73,684,344 M410T probably damaging Het
Sntb1 A T 15: 55,647,955 L411H probably damaging Het
Synj2 A G 17: 6,023,665 K245E probably damaging Het
Tmem131 G A 1: 36,825,478 T558I probably damaging Het
Tnrc18 A T 5: 142,771,533 S1078T unknown Het
Trmu T A 15: 85,897,101 probably null Het
Ttn A T 2: 76,891,086 probably benign Het
Tyw3 T C 3: 154,587,523 T172A probably benign Het
Vldlr T C 19: 27,239,721 I348T possibly damaging Het
Zfp114 A G 7: 24,177,769 D12G probably damaging Het
Other mutations in Myo3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Myo3a APN 2 22332473 missense probably benign 0.42
IGL01307:Myo3a APN 2 22558289 missense probably damaging 1.00
IGL01413:Myo3a APN 2 22297600 missense probably benign 0.25
IGL01655:Myo3a APN 2 22423326 missense probably damaging 1.00
IGL01767:Myo3a APN 2 22423222 missense probably damaging 0.96
IGL01803:Myo3a APN 2 22241115 missense probably damaging 1.00
IGL01969:Myo3a APN 2 22297688 missense probably benign 0.03
IGL02043:Myo3a APN 2 22399965 missense probably benign 0.01
IGL02124:Myo3a APN 2 22577526 missense probably benign 0.01
IGL02174:Myo3a APN 2 22332393 missense probably benign 0.04
IGL02649:Myo3a APN 2 22323607 missense probably benign
IGL02976:Myo3a APN 2 22542452 nonsense probably null
IGL03328:Myo3a APN 2 22578198 missense probably benign 0.02
IGL03376:Myo3a APN 2 22600074 splice site probably benign
lose UTSW 2 22558320 nonsense probably null
snooze UTSW 2 22282634 missense probably damaging 0.99
A5278:Myo3a UTSW 2 22323653 missense probably benign 0.27
PIT4445001:Myo3a UTSW 2 22542415 missense possibly damaging 0.64
R0008:Myo3a UTSW 2 22579741 missense probably damaging 0.99
R0099:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0212:Myo3a UTSW 2 22291848 missense probably damaging 1.00
R0281:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0282:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0492:Myo3a UTSW 2 22323636 missense possibly damaging 0.46
R0498:Myo3a UTSW 2 22577429 missense possibly damaging 0.74
R0594:Myo3a UTSW 2 22544332 splice site probably benign
R0609:Myo3a UTSW 2 22333513 missense probably benign 0.29
R0609:Myo3a UTSW 2 22396299 missense possibly damaging 0.95
R0827:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R0968:Myo3a UTSW 2 22558289 missense probably damaging 1.00
R1157:Myo3a UTSW 2 22542414 critical splice acceptor site probably null
R1301:Myo3a UTSW 2 22267095 splice site probably benign
R1352:Myo3a UTSW 2 22323675 critical splice donor site probably null
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1517:Myo3a UTSW 2 22282634 missense probably damaging 0.99
R1565:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1712:Myo3a UTSW 2 22564992 missense probably damaging 1.00
R1722:Myo3a UTSW 2 22399827 missense probably benign 0.03
R1822:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1823:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1824:Myo3a UTSW 2 22396243 missense probably benign
R1837:Myo3a UTSW 2 22577592 missense possibly damaging 0.76
R1867:Myo3a UTSW 2 22399846 missense probably benign 0.00
R1917:Myo3a UTSW 2 22291922 missense probably damaging 1.00
R1920:Myo3a UTSW 2 22564996 missense probably benign 0.02
R1937:Myo3a UTSW 2 22396315 missense probably damaging 1.00
R1954:Myo3a UTSW 2 22241226 missense probably damaging 1.00
R1988:Myo3a UTSW 2 22578128 missense possibly damaging 0.86
R2091:Myo3a UTSW 2 22333677 missense probably damaging 0.99
R2115:Myo3a UTSW 2 22245531 missense probably damaging 1.00
R2125:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2126:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2216:Myo3a UTSW 2 22577771 missense probably benign 0.00
R2413:Myo3a UTSW 2 22577912 missense probably benign 0.00
R2964:Myo3a UTSW 2 22340256 missense possibly damaging 0.90
R3196:Myo3a UTSW 2 22399868 missense possibly damaging 0.86
R3837:Myo3a UTSW 2 22565109 splice site probably benign
R3905:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R3926:Myo3a UTSW 2 22565041 missense probably damaging 0.99
R4014:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4015:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4017:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4043:Myo3a UTSW 2 22333539 splice site probably benign
R4044:Myo3a UTSW 2 22577700 missense probably damaging 0.99
R4057:Myo3a UTSW 2 22266160 missense probably benign 0.01
R4192:Myo3a UTSW 2 22407377 missense probably damaging 1.00
R4282:Myo3a UTSW 2 22340278 missense probably benign 0.14
R4321:Myo3a UTSW 2 22267155 missense probably damaging 1.00
R4393:Myo3a UTSW 2 22577854 missense probably damaging 0.99
R4398:Myo3a UTSW 2 22577842 missense probably benign
R4446:Myo3a UTSW 2 22600137 missense probably damaging 1.00
R4685:Myo3a UTSW 2 22407422 missense probably damaging 1.00
R5032:Myo3a UTSW 2 22282602 missense probably damaging 1.00
R5096:Myo3a UTSW 2 22574242 missense probably benign 0.16
R5183:Myo3a UTSW 2 22578158 missense probably benign 0.05
R5458:Myo3a UTSW 2 22245550 missense probably damaging 1.00
R5502:Myo3a UTSW 2 22558369 missense probably damaging 1.00
R5522:Myo3a UTSW 2 22574341 missense probably damaging 1.00
R6462:Myo3a UTSW 2 22558411 missense probably damaging 1.00
R6479:Myo3a UTSW 2 22577865 missense probably benign 0.00
R6513:Myo3a UTSW 2 22407332 missense probably damaging 1.00
R6520:Myo3a UTSW 2 22399926 missense possibly damaging 0.90
R6602:Myo3a UTSW 2 22577787 missense probably damaging 0.96
R6671:Myo3a UTSW 2 22294522 missense probably damaging 1.00
R6743:Myo3a UTSW 2 22361664 missense probably benign 0.24
R6865:Myo3a UTSW 2 22574301 missense probably benign 0.00
R6961:Myo3a UTSW 2 22245558 missense probably benign 0.00
R7001:Myo3a UTSW 2 22332377 missense probably benign 0.04
R7215:Myo3a UTSW 2 22245567 missense possibly damaging 0.78
R7301:Myo3a UTSW 2 22544466 critical splice donor site probably null
R7318:Myo3a UTSW 2 22558320 nonsense probably null
R7447:Myo3a UTSW 2 22544426 missense probably benign 0.27
R7456:Myo3a UTSW 2 22407444 missense probably benign 0.08
R7528:Myo3a UTSW 2 22266114 nonsense probably null
R7731:Myo3a UTSW 2 22282589 missense probably damaging 1.00
R7768:Myo3a UTSW 2 22241143 missense probably damaging 0.99
R8054:Myo3a UTSW 2 22574317 missense probably benign 0.00
R8140:Myo3a UTSW 2 22407346 missense probably damaging 1.00
R8143:Myo3a UTSW 2 22282665 critical splice donor site probably null
R8346:Myo3a UTSW 2 22558422 critical splice donor site probably null
R8421:Myo3a UTSW 2 22362124 missense probably benign 0.07
R8495:Myo3a UTSW 2 22396273 missense probably damaging 0.96
R8551:Myo3a UTSW 2 22332466 missense probably benign 0.00
R8708:Myo3a UTSW 2 22291796 splice site probably benign
R8757:Myo3a UTSW 2 22558307 missense possibly damaging 0.49
R8759:Myo3a UTSW 2 22558307 missense possibly damaging 0.49
R8779:Myo3a UTSW 2 22245593 nonsense probably null
R8828:Myo3a UTSW 2 22241053 missense probably benign 0.01
R8910:Myo3a UTSW 2 22574268 missense probably benign 0.01
R8916:Myo3a UTSW 2 22567692 missense probably damaging 1.00
R8926:Myo3a UTSW 2 22396263 missense possibly damaging 0.95
R9028:Myo3a UTSW 2 22600087 missense possibly damaging 0.79
R9046:Myo3a UTSW 2 22558355 missense probably damaging 0.99
R9120:Myo3a UTSW 2 22544426 missense probably benign 0.27
R9153:Myo3a UTSW 2 22399933 missense probably benign 0.02
R9191:Myo3a UTSW 2 22579829 missense probably benign 0.24
R9258:Myo3a UTSW 2 22577533 missense possibly damaging 0.60
R9436:Myo3a UTSW 2 22407424 nonsense probably null
R9464:Myo3a UTSW 2 22227572 start gained probably benign
R9487:Myo3a UTSW 2 22241051 missense probably benign
R9719:Myo3a UTSW 2 22544455 missense probably benign 0.02
R9799:Myo3a UTSW 2 22600169 missense probably damaging 1.00
Z1177:Myo3a UTSW 2 22618140 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TGATGTTTCAGCCCAGTGGCAG -3'
(R):5'- TCTGGGAAACAGCAACCCACTTTAC -3'

Sequencing Primer
(F):5'- GCTCTGAGGGAACAGACTGC -3'
(R):5'- cctgtaatctcagcattcagaag -3'
Posted On 2014-03-14