Mutagenetix > Incidental Mutation

Incidental Mutation 'R1443:Mylk2'

158628

Institutional Source

Beutler Lab

Gene Symbol

Mylk2

Ensembl Gene

ENSMUSG00000027470

Gene Name

myosin, light polypeptide kinase 2, skeletal muscle

Synonyms

MMRRC Submission

039498-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.266) question?

Stock #

R1443 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

152911352-152923068 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 152919416 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 480 (T480A)

Ref Sequence

ENSEMBL: ENSMUSP00000028970 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028970]

AlphaFold

Q8VCR8

Predicted Effect

probably damaging
Transcript: ENSMUST00000028970
AA Change: T480A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028970
Gene: ENSMUSG00000027470
AA Change: T480A

Domain	Start	End	E-Value	Type
low complexity region	90	122	N/A	INTRINSIC
low complexity region	142	157	N/A	INTRINSIC
low complexity region	216	228	N/A	INTRINSIC
low complexity region	278	285	N/A	INTRINSIC
S_TKc	302	557	6.08e-87	SMART

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.2%
20x: 85.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a myosin light chain kinase, a calcium/calmodulin dependent enzyme, that is exclusively expressed in adult skeletal muscle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout mice display impaired skeletal muscle twitch tension response to tetanic stimulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,262,798	S56R	probably damaging	Het
Actr8	A	G	14: 29,984,099	M99V	possibly damaging	Het
Adamtsl2	T	A	2: 27,103,066	C703S	possibly damaging	Het
Afap1	G	T	5: 35,968,661	K333N	probably damaging	Het
Aldh3a2	G	A	11: 61,264,307	S137L	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Aoc1	A	T	6: 48,905,445	K107M	possibly damaging	Het
Bmp8a	G	T	4: 123,316,965	S252R	possibly damaging	Het
C7	T	C	15: 5,059,419	I13M	probably benign	Het
Cblb	T	A	16: 52,139,611	D322E	possibly damaging	Het
Cfap54	G	A	10: 92,932,721	T180I	probably damaging	Het
Clrn2	C	T	5: 45,460,111	A108V	probably damaging	Het
Cspg4	T	A	9: 56,886,512	D510E	probably damaging	Het
Cyp2c40	A	T	19: 39,777,971	N393K	possibly damaging	Het
Dcaf5	T	C	12: 80,364,069	Y294C	probably damaging	Het
Dclk3	T	A	9: 111,469,020	M544K	probably benign	Het
Doxl2	A	T	6: 48,975,915	Y258F	probably damaging	Het
Ell3	A	T	2: 121,439,465	F388I	probably damaging	Het
Fam208b	T	C	13: 3,575,543	K1469R	probably benign	Het
Fam78b	A	G	1: 167,078,760	I163V	probably damaging	Het
Gnptab	T	C	10: 88,434,081	L882P	probably damaging	Het
Herc2	A	T	7: 56,204,733	D3802V	possibly damaging	Het
Hs3st5	A	G	10: 36,833,414	E315G	probably benign	Het
Idh3b	A	T	2: 130,284,054		probably null	Het
Lama4	G	A	10: 39,073,643	E911K	probably damaging	Het
Macf1	A	G	4: 123,511,007	I436T	probably damaging	Het
Mgam	C	A	6: 40,759,780	S871*	probably null	Het
Mtmr7	A	G	8: 40,560,882	S212P	probably damaging	Het
Myo3a	A	T	2: 22,282,626	N191I	probably damaging	Het
Nanog	C	T	6: 122,711,775	S105F	probably damaging	Het
Nanos2	A	G	7: 18,987,639	Y12C	probably damaging	Het
Nsg1	C	T	5: 38,155,643	V71I	probably benign	Het
Olfr1368	C	T	13: 21,142,167	V297I	probably benign	Het
Olfr1458	G	T	19: 13,103,204	Y33*	probably null	Het
Olfr1512	A	T	14: 52,372,951	I34N	probably damaging	Het
Olfr211	T	C	6: 116,494,425	L272S	probably benign	Het
Olfr643	A	T	7: 104,058,723	I293N	probably damaging	Het
Pcdhb17	A	G	18: 37,486,648	Q497R	probably benign	Het
Pcsk7	C	A	9: 45,925,986	P536Q	probably damaging	Het
Phactr4	G	A	4: 132,377,248	T256I	probably benign	Het
Phyhip	A	G	14: 70,467,291	K317E	probably damaging	Het
Pkhd1	C	T	1: 20,534,558	G1178R	probably damaging	Het
Ppp1r9a	G	A	6: 5,057,557	G544D	probably damaging	Het
Ptpn3	T	C	4: 57,225,775	D480G	probably benign	Het
Ptprn2	A	T	12: 117,253,615	K918N	probably damaging	Het
Rab42	T	C	4: 132,302,347	D188G	probably benign	Het
Rasgrf2	C	A	13: 91,983,676	D20Y	probably damaging	Het
Ryr2	G	A	13: 11,779,266	T942I	probably benign	Het
Sbpl	T	C	17: 23,953,354	K197R	unknown	Het
Slc44a1	T	A	4: 53,561,069	V595E	probably damaging	Het
Slc6a19	A	G	13: 73,684,344	M410T	probably damaging	Het
Sntb1	A	T	15: 55,647,955	L411H	probably damaging	Het
Synj2	A	G	17: 6,023,665	K245E	probably damaging	Het
Tmem131	G	A	1: 36,825,478	T558I	probably damaging	Het
Tnrc18	A	T	5: 142,771,533	S1078T	unknown	Het
Trmu	T	A	15: 85,897,101		probably null	Het
Ttn	A	T	2: 76,891,086		probably benign	Het
Tyw3	T	C	3: 154,587,523	T172A	probably benign	Het
Vldlr	T	C	19: 27,239,721	I348T	possibly damaging	Het
Zfp114	A	G	7: 24,177,769	D12G	probably damaging	Het

Other mutations in Mylk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01870:Mylk2	APN	2	152915214	missense	probably benign	0.20
IGL02097:Mylk2	APN	2	152915136	missense	probably damaging	0.98
IGL02158:Mylk2	APN	2	152919157	missense	probably damaging	1.00
IGL02189:Mylk2	APN	2	152915154	missense	probably damaging	1.00
IGL02243:Mylk2	APN	2	152920553	missense	probably damaging	1.00
IGL02716:Mylk2	APN	2	152922153	makesense	probably null
IGL02946:Mylk2	APN	2	152919210	nonsense	probably null
IGL03105:Mylk2	APN	2	152917359	missense	possibly damaging	0.94
R1184:Mylk2	UTSW	2	152913741	critical splice donor site	probably null
R1957:Mylk2	UTSW	2	152917607	missense	possibly damaging	0.86
R2496:Mylk2	UTSW	2	152913668	missense	probably damaging	1.00
R2870:Mylk2	UTSW	2	152919348	missense	probably damaging	1.00
R2870:Mylk2	UTSW	2	152919348	missense	probably damaging	1.00
R3081:Mylk2	UTSW	2	152919354	missense	probably benign	0.31
R4510:Mylk2	UTSW	2	152917410	missense	probably damaging	1.00
R4511:Mylk2	UTSW	2	152917410	missense	probably damaging	1.00
R4600:Mylk2	UTSW	2	152917556	missense	probably damaging	1.00
R4633:Mylk2	UTSW	2	152917415	missense	probably benign	0.00
R4890:Mylk2	UTSW	2	152920354	missense	possibly damaging	0.88
R5267:Mylk2	UTSW	2	152913549	missense	probably benign
R5430:Mylk2	UTSW	2	152917548	missense	probably damaging	1.00
R5447:Mylk2	UTSW	2	152912510	missense	probably damaging	0.96
R6167:Mylk2	UTSW	2	152915753	splice site	probably null
R6327:Mylk2	UTSW	2	152913693	missense	possibly damaging	0.77
R6391:Mylk2	UTSW	2	152917395	missense	probably damaging	1.00
R6913:Mylk2	UTSW	2	152913690	missense	possibly damaging	0.76
R7066:Mylk2	UTSW	2	152911668	splice site	probably null
R7092:Mylk2	UTSW	2	152915190	missense	probably benign	0.21
R7403:Mylk2	UTSW	2	152917341	missense	probably damaging	1.00
R7442:Mylk2	UTSW	2	152911426	start gained	probably benign
R7443:Mylk2	UTSW	2	152911426	start gained	probably benign
R7453:Mylk2	UTSW	2	152912433	missense	probably damaging	1.00
R7477:Mylk2	UTSW	2	152920341	missense	probably damaging	1.00
R7529:Mylk2	UTSW	2	152915704	missense	probably damaging	1.00
R8029:Mylk2	UTSW	2	152920299	missense	probably damaging	1.00
R9339:Mylk2	UTSW	2	152913450	missense	probably damaging	1.00
R9462:Mylk2	UTSW	2	152919453	missense	probably damaging	1.00
R9525:Mylk2	UTSW	2	152917632	missense	probably damaging	0.99
Z1177:Mylk2	UTSW	2	152920330	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGCATGACAGGTCTCTGAGTCCTAC -3'
(R):5'- CTGGTTCTCCCTAGCATTCACCAAAG -3'

Sequencing Primer
(F):5'- TGAATACCACTGGGCACTTG -3'
(R):5'- AGAAATGCACCCAGGCTG -3'

Posted On

2014-03-14