Incidental Mutation 'R1443:Ptpn3'
ID 158632
Institutional Source Beutler Lab
Gene Symbol Ptpn3
Ensembl Gene ENSMUSG00000038764
Gene Name protein tyrosine phosphatase, non-receptor type 3
Synonyms 9530011I20Rik, PTP-H1, PTPCL
MMRRC Submission 039498-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.632) question?
Stock # R1443 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 57190841-57301837 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57225775 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 480 (D480G)
Ref Sequence ENSEMBL: ENSMUSP00000075063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075637]
AlphaFold A2ALK8
Predicted Effect probably benign
Transcript: ENSMUST00000075637
AA Change: D480G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000075063
Gene: ENSMUSG00000038764
AA Change: D480G

DomainStartEndE-ValueType
B41 25 222 2.44e-67 SMART
FERM_C 226 316 2.64e-25 SMART
low complexity region 454 470 N/A INTRINSIC
PDZ 519 598 1.65e-15 SMART
PTPc 645 903 5.66e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123664
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 85.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. P97, a cell cycle regulator involved in a variety of membrane related functions, has been shown to be a substrate of this PTP. This PTP was also found to interact with, and be regulated by adaptor protein 14-3-3 beta. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit increased body weight, especially in males, and male mice exhibit increased bone mineral content. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 A G 14: 29,706,056 (GRCm39) M99V possibly damaging Het
Adamtsl2 T A 2: 26,993,078 (GRCm39) C703S possibly damaging Het
Afap1 G T 5: 36,126,005 (GRCm39) K333N probably damaging Het
Aldh3a2 G A 11: 61,155,133 (GRCm39) S137L probably damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Aoc1 A T 6: 48,882,379 (GRCm39) K107M possibly damaging Het
Aoc1l1 A T 6: 48,952,849 (GRCm39) Y258F probably damaging Het
Bltp2 T A 11: 78,153,624 (GRCm39) S56R probably damaging Het
Bmp8a G T 4: 123,210,758 (GRCm39) S252R possibly damaging Het
C7 T C 15: 5,088,901 (GRCm39) I13M probably benign Het
Cblb T A 16: 51,959,974 (GRCm39) D322E possibly damaging Het
Cfap54 G A 10: 92,768,583 (GRCm39) T180I probably damaging Het
Clrn2 C T 5: 45,617,453 (GRCm39) A108V probably damaging Het
Cspg4 T A 9: 56,793,796 (GRCm39) D510E probably damaging Het
Cyp2c40 A T 19: 39,766,415 (GRCm39) N393K possibly damaging Het
Dcaf5 T C 12: 80,410,843 (GRCm39) Y294C probably damaging Het
Dclk3 T A 9: 111,298,088 (GRCm39) M544K probably benign Het
Ell3 A T 2: 121,269,946 (GRCm39) F388I probably damaging Het
Fam78b A G 1: 166,906,329 (GRCm39) I163V probably damaging Het
Gnptab T C 10: 88,269,943 (GRCm39) L882P probably damaging Het
Herc2 A T 7: 55,854,481 (GRCm39) D3802V possibly damaging Het
Hs3st5 A G 10: 36,709,410 (GRCm39) E315G probably benign Het
Idh3b A T 2: 130,125,974 (GRCm39) probably null Het
Lama4 G A 10: 38,949,639 (GRCm39) E911K probably damaging Het
Macf1 A G 4: 123,404,800 (GRCm39) I436T probably damaging Het
Mgam C A 6: 40,736,714 (GRCm39) S871* probably null Het
Mtmr7 A G 8: 41,013,923 (GRCm39) S212P probably damaging Het
Mylk2 A G 2: 152,761,336 (GRCm39) T480A probably damaging Het
Myo3a A T 2: 22,287,437 (GRCm39) N191I probably damaging Het
Nanog C T 6: 122,688,734 (GRCm39) S105F probably damaging Het
Nanos2 A G 7: 18,721,564 (GRCm39) Y12C probably damaging Het
Nsg1 C T 5: 38,312,987 (GRCm39) V71I probably benign Het
Or10g3 A T 14: 52,610,408 (GRCm39) I34N probably damaging Het
Or13a1 T C 6: 116,471,386 (GRCm39) L272S probably benign Het
Or2ad1 C T 13: 21,326,337 (GRCm39) V297I probably benign Het
Or51a42 A T 7: 103,707,930 (GRCm39) I293N probably damaging Het
Or5b105 G T 19: 13,080,568 (GRCm39) Y33* probably null Het
Pcdhb17 A G 18: 37,619,701 (GRCm39) Q497R probably benign Het
Pcsk7 C A 9: 45,837,284 (GRCm39) P536Q probably damaging Het
Phactr4 G A 4: 132,104,559 (GRCm39) T256I probably benign Het
Phyhip A G 14: 70,704,731 (GRCm39) K317E probably damaging Het
Pkhd1 C T 1: 20,604,782 (GRCm39) G1178R probably damaging Het
Ppp1r9a G A 6: 5,057,557 (GRCm39) G544D probably damaging Het
Ptprn2 A T 12: 117,217,235 (GRCm39) K918N probably damaging Het
Rab42 T C 4: 132,029,658 (GRCm39) D188G probably benign Het
Rasgrf2 C A 13: 92,131,795 (GRCm39) D20Y probably damaging Het
Ryr2 G A 13: 11,794,152 (GRCm39) T942I probably benign Het
Sbpl T C 17: 24,172,328 (GRCm39) K197R unknown Het
Slc44a1 T A 4: 53,561,069 (GRCm39) V595E probably damaging Het
Slc6a19 A G 13: 73,832,463 (GRCm39) M410T probably damaging Het
Sntb1 A T 15: 55,511,351 (GRCm39) L411H probably damaging Het
Synj2 A G 17: 6,073,940 (GRCm39) K245E probably damaging Het
Tasor2 T C 13: 3,625,543 (GRCm39) K1469R probably benign Het
Tmem131 G A 1: 36,864,559 (GRCm39) T558I probably damaging Het
Tnrc18 A T 5: 142,757,288 (GRCm39) S1078T unknown Het
Trmu T A 15: 85,781,302 (GRCm39) probably null Het
Ttn A T 2: 76,721,430 (GRCm39) probably benign Het
Tyw3 T C 3: 154,293,160 (GRCm39) T172A probably benign Het
Vldlr T C 19: 27,217,121 (GRCm39) I348T possibly damaging Het
Zfp114 A G 7: 23,877,194 (GRCm39) D12G probably damaging Het
Other mutations in Ptpn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Ptpn3 APN 4 57,270,050 (GRCm39) missense possibly damaging 0.95
IGL01090:Ptpn3 APN 4 57,240,833 (GRCm39) missense probably damaging 1.00
IGL01399:Ptpn3 APN 4 57,225,775 (GRCm39) missense probably benign 0.01
IGL01413:Ptpn3 APN 4 57,270,156 (GRCm39) missense probably damaging 0.96
IGL01418:Ptpn3 APN 4 57,270,156 (GRCm39) missense probably damaging 0.96
IGL01806:Ptpn3 APN 4 57,254,915 (GRCm39) critical splice donor site probably null
IGL01933:Ptpn3 APN 4 57,197,576 (GRCm39) missense probably benign 0.00
IGL02087:Ptpn3 APN 4 57,222,019 (GRCm39) missense probably damaging 1.00
IGL02269:Ptpn3 APN 4 57,197,510 (GRCm39) missense possibly damaging 0.72
IGL02413:Ptpn3 APN 4 57,205,020 (GRCm39) missense probably damaging 1.00
IGL03163:Ptpn3 APN 4 57,222,020 (GRCm39) missense probably damaging 1.00
R0179:Ptpn3 UTSW 4 57,270,118 (GRCm39) missense probably benign 0.00
R0240:Ptpn3 UTSW 4 57,232,374 (GRCm39) missense probably benign
R0240:Ptpn3 UTSW 4 57,232,374 (GRCm39) missense probably benign
R0310:Ptpn3 UTSW 4 57,204,958 (GRCm39) missense probably benign 0.00
R0492:Ptpn3 UTSW 4 57,194,304 (GRCm39) missense probably benign
R0631:Ptpn3 UTSW 4 57,204,921 (GRCm39) missense probably damaging 0.99
R0656:Ptpn3 UTSW 4 57,270,075 (GRCm39) missense probably benign 0.41
R1741:Ptpn3 UTSW 4 57,254,922 (GRCm39) missense probably damaging 1.00
R1856:Ptpn3 UTSW 4 57,239,682 (GRCm39) missense probably damaging 1.00
R3753:Ptpn3 UTSW 4 57,270,144 (GRCm39) missense probably damaging 1.00
R4431:Ptpn3 UTSW 4 57,235,355 (GRCm39) missense probably damaging 0.97
R4704:Ptpn3 UTSW 4 57,270,119 (GRCm39) missense possibly damaging 0.79
R4935:Ptpn3 UTSW 4 57,197,568 (GRCm39) missense probably damaging 1.00
R5119:Ptpn3 UTSW 4 57,218,513 (GRCm39) missense possibly damaging 0.93
R5410:Ptpn3 UTSW 4 57,205,019 (GRCm39) missense probably damaging 1.00
R5554:Ptpn3 UTSW 4 57,240,843 (GRCm39) missense probably damaging 0.99
R6024:Ptpn3 UTSW 4 57,248,653 (GRCm39) splice site probably null
R6061:Ptpn3 UTSW 4 57,248,681 (GRCm39) missense probably damaging 1.00
R6212:Ptpn3 UTSW 4 57,270,070 (GRCm39) missense probably damaging 1.00
R6213:Ptpn3 UTSW 4 57,265,012 (GRCm39) missense probably damaging 1.00
R6239:Ptpn3 UTSW 4 57,249,981 (GRCm39) missense probably benign
R6444:Ptpn3 UTSW 4 57,195,730 (GRCm39) missense possibly damaging 0.51
R6606:Ptpn3 UTSW 4 57,265,104 (GRCm39) splice site probably null
R6656:Ptpn3 UTSW 4 57,205,905 (GRCm39) missense probably damaging 0.99
R6730:Ptpn3 UTSW 4 57,270,088 (GRCm39) missense probably benign
R7133:Ptpn3 UTSW 4 57,225,863 (GRCm39) missense probably benign 0.30
R7231:Ptpn3 UTSW 4 57,245,062 (GRCm39) missense probably damaging 1.00
R7237:Ptpn3 UTSW 4 57,239,625 (GRCm39) missense probably damaging 1.00
R7368:Ptpn3 UTSW 4 57,221,993 (GRCm39) missense probably damaging 1.00
R7604:Ptpn3 UTSW 4 57,240,845 (GRCm39) missense probably damaging 0.99
R7742:Ptpn3 UTSW 4 57,265,092 (GRCm39) critical splice acceptor site probably null
R8023:Ptpn3 UTSW 4 57,248,688 (GRCm39) missense probably benign 0.02
R8099:Ptpn3 UTSW 4 57,204,985 (GRCm39) nonsense probably null
R8155:Ptpn3 UTSW 4 57,232,336 (GRCm39) missense probably benign
R8302:Ptpn3 UTSW 4 57,218,514 (GRCm39) missense probably benign 0.01
R8315:Ptpn3 UTSW 4 57,270,063 (GRCm39) missense possibly damaging 0.88
R8335:Ptpn3 UTSW 4 57,235,286 (GRCm39) missense probably damaging 0.99
R8346:Ptpn3 UTSW 4 57,225,547 (GRCm39) missense probably damaging 0.99
R8348:Ptpn3 UTSW 4 57,240,784 (GRCm39) critical splice donor site probably null
R8448:Ptpn3 UTSW 4 57,240,784 (GRCm39) critical splice donor site probably null
R8513:Ptpn3 UTSW 4 57,270,085 (GRCm39) nonsense probably null
R8846:Ptpn3 UTSW 4 57,205,020 (GRCm39) missense probably damaging 1.00
R9244:Ptpn3 UTSW 4 57,254,915 (GRCm39) critical splice donor site probably null
R9337:Ptpn3 UTSW 4 57,218,521 (GRCm39) missense probably damaging 0.96
R9478:Ptpn3 UTSW 4 57,197,573 (GRCm39) missense probably damaging 1.00
R9500:Ptpn3 UTSW 4 57,205,914 (GRCm39) missense possibly damaging 0.83
R9710:Ptpn3 UTSW 4 57,249,957 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGTAGCCATCTCCATCGTCACTC -3'
(R):5'- TGCAGAAATGCTCAGGTTCCAGG -3'

Sequencing Primer
(F):5'- ACGTGAGAGGGTTGTTTACACC -3'
(R):5'- TGGTGATCTCAAGATGCCAGC -3'
Posted On 2014-03-14