Mutagenetix > Incidental Mutation

Incidental Mutation 'R1443:Ptpn3'

158632

Institutional Source

Beutler Lab

Gene Symbol

Ptpn3

Ensembl Gene

ENSMUSG00000038764

Gene Name

protein tyrosine phosphatase, non-receptor type 3

Synonyms

9530011I20Rik, PTPCL, PTP-H1

MMRRC Submission

039498-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.540) question?

Stock #

R1443 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57190841-57301837 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 57225775 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 480 (D480G)

Ref Sequence

ENSEMBL: ENSMUSP00000075063 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075637]

AlphaFold

A2ALK8

Predicted Effect

probably benign
Transcript: ENSMUST00000075637
AA Change: D480G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000075063
Gene: ENSMUSG00000038764
AA Change: D480G

Domain	Start	End	E-Value	Type
B41	25	222	2.44e-67	SMART
FERM_C	226	316	2.64e-25	SMART
low complexity region	454	470	N/A	INTRINSIC
PDZ	519	598	1.65e-15	SMART
PTPc	645	903	5.66e-117	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123664

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.2%
20x: 85.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. P97, a cell cycle regulator involved in a variety of membrane related functions, has been shown to be a substrate of this PTP. This PTP was also found to interact with, and be regulated by adaptor protein 14-3-3 beta. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit increased body weight, especially in males, and male mice exhibit increased bone mineral content. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,262,798	S56R	probably damaging	Het
Actr8	A	G	14: 29,984,099	M99V	possibly damaging	Het
Adamtsl2	T	A	2: 27,103,066	C703S	possibly damaging	Het
Afap1	G	T	5: 35,968,661	K333N	probably damaging	Het
Aldh3a2	G	A	11: 61,264,307	S137L	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Aoc1	A	T	6: 48,905,445	K107M	possibly damaging	Het
Bmp8a	G	T	4: 123,316,965	S252R	possibly damaging	Het
C7	T	C	15: 5,059,419	I13M	probably benign	Het
Cblb	T	A	16: 52,139,611	D322E	possibly damaging	Het
Cfap54	G	A	10: 92,932,721	T180I	probably damaging	Het
Clrn2	C	T	5: 45,460,111	A108V	probably damaging	Het
Cspg4	T	A	9: 56,886,512	D510E	probably damaging	Het
Cyp2c40	A	T	19: 39,777,971	N393K	possibly damaging	Het
Dcaf5	T	C	12: 80,364,069	Y294C	probably damaging	Het
Dclk3	T	A	9: 111,469,020	M544K	probably benign	Het
Doxl2	A	T	6: 48,975,915	Y258F	probably damaging	Het
Ell3	A	T	2: 121,439,465	F388I	probably damaging	Het
Fam208b	T	C	13: 3,575,543	K1469R	probably benign	Het
Fam78b	A	G	1: 167,078,760	I163V	probably damaging	Het
Gnptab	T	C	10: 88,434,081	L882P	probably damaging	Het
Herc2	A	T	7: 56,204,733	D3802V	possibly damaging	Het
Hs3st5	A	G	10: 36,833,414	E315G	probably benign	Het
Idh3b	A	T	2: 130,284,054		probably null	Het
Lama4	G	A	10: 39,073,643	E911K	probably damaging	Het
Macf1	A	G	4: 123,511,007	I436T	probably damaging	Het
Mgam	C	A	6: 40,759,780	S871*	probably null	Het
Mtmr7	A	G	8: 40,560,882	S212P	probably damaging	Het
Mylk2	A	G	2: 152,919,416	T480A	probably damaging	Het
Myo3a	A	T	2: 22,282,626	N191I	probably damaging	Het
Nanog	C	T	6: 122,711,775	S105F	probably damaging	Het
Nanos2	A	G	7: 18,987,639	Y12C	probably damaging	Het
Nsg1	C	T	5: 38,155,643	V71I	probably benign	Het
Olfr1368	C	T	13: 21,142,167	V297I	probably benign	Het
Olfr1458	G	T	19: 13,103,204	Y33*	probably null	Het
Olfr1512	A	T	14: 52,372,951	I34N	probably damaging	Het
Olfr211	T	C	6: 116,494,425	L272S	probably benign	Het
Olfr643	A	T	7: 104,058,723	I293N	probably damaging	Het
Pcdhb17	A	G	18: 37,486,648	Q497R	probably benign	Het
Pcsk7	C	A	9: 45,925,986	P536Q	probably damaging	Het
Phactr4	G	A	4: 132,377,248	T256I	probably benign	Het
Phyhip	A	G	14: 70,467,291	K317E	probably damaging	Het
Pkhd1	C	T	1: 20,534,558	G1178R	probably damaging	Het
Ppp1r9a	G	A	6: 5,057,557	G544D	probably damaging	Het
Ptprn2	A	T	12: 117,253,615	K918N	probably damaging	Het
Rab42	T	C	4: 132,302,347	D188G	probably benign	Het
Rasgrf2	C	A	13: 91,983,676	D20Y	probably damaging	Het
Ryr2	G	A	13: 11,779,266	T942I	probably benign	Het
Sbpl	T	C	17: 23,953,354	K197R	unknown	Het
Slc44a1	T	A	4: 53,561,069	V595E	probably damaging	Het
Slc6a19	A	G	13: 73,684,344	M410T	probably damaging	Het
Sntb1	A	T	15: 55,647,955	L411H	probably damaging	Het
Synj2	A	G	17: 6,023,665	K245E	probably damaging	Het
Tmem131	G	A	1: 36,825,478	T558I	probably damaging	Het
Tnrc18	A	T	5: 142,771,533	S1078T	unknown	Het
Trmu	T	A	15: 85,897,101		probably null	Het
Ttn	A	T	2: 76,891,086		probably benign	Het
Tyw3	T	C	3: 154,587,523	T172A	probably benign	Het
Vldlr	T	C	19: 27,239,721	I348T	possibly damaging	Het
Zfp114	A	G	7: 24,177,769	D12G	probably damaging	Het

Other mutations in Ptpn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00905:Ptpn3	APN	4	57270050	missense	possibly damaging	0.95
IGL01090:Ptpn3	APN	4	57240833	missense	probably damaging	1.00
IGL01399:Ptpn3	APN	4	57225775	missense	probably benign	0.01
IGL01413:Ptpn3	APN	4	57270156	missense	probably damaging	0.96
IGL01418:Ptpn3	APN	4	57270156	missense	probably damaging	0.96
IGL01806:Ptpn3	APN	4	57254915	critical splice donor site	probably null
IGL01933:Ptpn3	APN	4	57197576	missense	probably benign	0.00
IGL02087:Ptpn3	APN	4	57222019	missense	probably damaging	1.00
IGL02269:Ptpn3	APN	4	57197510	missense	possibly damaging	0.72
IGL02413:Ptpn3	APN	4	57205020	missense	probably damaging	1.00
IGL03163:Ptpn3	APN	4	57222020	missense	probably damaging	1.00
R0179:Ptpn3	UTSW	4	57270118	missense	probably benign	0.00
R0240:Ptpn3	UTSW	4	57232374	missense	probably benign
R0240:Ptpn3	UTSW	4	57232374	missense	probably benign
R0310:Ptpn3	UTSW	4	57204958	missense	probably benign	0.00
R0492:Ptpn3	UTSW	4	57194304	missense	probably benign
R0631:Ptpn3	UTSW	4	57204921	missense	probably damaging	0.99
R0656:Ptpn3	UTSW	4	57270075	missense	probably benign	0.41
R1741:Ptpn3	UTSW	4	57254922	missense	probably damaging	1.00
R1856:Ptpn3	UTSW	4	57239682	missense	probably damaging	1.00
R3753:Ptpn3	UTSW	4	57270144	missense	probably damaging	1.00
R4431:Ptpn3	UTSW	4	57235355	missense	probably damaging	0.97
R4704:Ptpn3	UTSW	4	57270119	missense	possibly damaging	0.79
R4935:Ptpn3	UTSW	4	57197568	missense	probably damaging	1.00
R5119:Ptpn3	UTSW	4	57218513	missense	possibly damaging	0.93
R5410:Ptpn3	UTSW	4	57205019	missense	probably damaging	1.00
R5554:Ptpn3	UTSW	4	57240843	missense	probably damaging	0.99
R6024:Ptpn3	UTSW	4	57248653	splice site	probably null
R6061:Ptpn3	UTSW	4	57248681	missense	probably damaging	1.00
R6212:Ptpn3	UTSW	4	57270070	missense	probably damaging	1.00
R6213:Ptpn3	UTSW	4	57265012	missense	probably damaging	1.00
R6239:Ptpn3	UTSW	4	57249981	missense	probably benign
R6444:Ptpn3	UTSW	4	57195730	missense	possibly damaging	0.51
R6606:Ptpn3	UTSW	4	57265104	splice site	probably null
R6656:Ptpn3	UTSW	4	57205905	missense	probably damaging	0.99
R6730:Ptpn3	UTSW	4	57270088	missense	probably benign
R7133:Ptpn3	UTSW	4	57225863	missense	probably benign	0.30
R7231:Ptpn3	UTSW	4	57245062	missense	probably damaging	1.00
R7237:Ptpn3	UTSW	4	57239625	missense	probably damaging	1.00
R7368:Ptpn3	UTSW	4	57221993	missense	probably damaging	1.00
R7604:Ptpn3	UTSW	4	57240845	missense	probably damaging	0.99
R7742:Ptpn3	UTSW	4	57265092	critical splice acceptor site	probably null
R8023:Ptpn3	UTSW	4	57248688	missense	probably benign	0.02
R8099:Ptpn3	UTSW	4	57204985	nonsense	probably null
R8155:Ptpn3	UTSW	4	57232336	missense	probably benign
R8302:Ptpn3	UTSW	4	57218514	missense	probably benign	0.01
R8315:Ptpn3	UTSW	4	57270063	missense	possibly damaging	0.88
R8335:Ptpn3	UTSW	4	57235286	missense	probably damaging	0.99
R8346:Ptpn3	UTSW	4	57225547	missense	probably damaging	0.99
R8348:Ptpn3	UTSW	4	57240784	critical splice donor site	probably null
R8448:Ptpn3	UTSW	4	57240784	critical splice donor site	probably null
R8513:Ptpn3	UTSW	4	57270085	nonsense	probably null
R8846:Ptpn3	UTSW	4	57205020	missense	probably damaging	1.00
R9244:Ptpn3	UTSW	4	57254915	critical splice donor site	probably null
R9337:Ptpn3	UTSW	4	57218521	missense	probably damaging	0.96
R9478:Ptpn3	UTSW	4	57197573	missense	probably damaging	1.00
R9500:Ptpn3	UTSW	4	57205914	missense	possibly damaging	0.83
R9710:Ptpn3	UTSW	4	57249957	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGGTAGCCATCTCCATCGTCACTC -3'
(R):5'- TGCAGAAATGCTCAGGTTCCAGG -3'

Sequencing Primer
(F):5'- ACGTGAGAGGGTTGTTTACACC -3'
(R):5'- TGGTGATCTCAAGATGCCAGC -3'

Posted On

2014-03-14