Incidental Mutation 'R1443:Alkbh2'
ID158640
Institutional Source Beutler Lab
Gene Symbol Alkbh2
Ensembl Gene ENSMUSG00000044339
Gene NamealkB homolog 2, alpha-ketoglutarate-dependent dioxygenase
SynonymsAbh2, mABH2
MMRRC Submission 039498-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1443 (G1)
Quality Score221
Status Not validated
Chromosome5
Chromosomal Location114123926-114128218 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 114124226 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 148 (E148K)
Ref Sequence ENSEMBL: ENSMUSP00000107898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031588] [ENSMUST00000053657] [ENSMUST00000112279] [ENSMUST00000149418] [ENSMUST00000200119]
Predicted Effect probably benign
Transcript: ENSMUST00000031588
SMART Domains Protein: ENSMUSP00000031588
Gene: ENSMUSG00000029592

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:UCH 67 499 2.6e-44 PFAM
Pfam:UCH_1 68 481 8.8e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000053657
AA Change: E148K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056043
Gene: ENSMUSG00000044339
AA Change: E148K

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:2OG-FeII_Oxy_2 47 232 1.9e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112279
AA Change: E148K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107898
Gene: ENSMUSG00000044339
AA Change: E148K

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:2OG-FeII_Oxy_2 47 232 5.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149418
Predicted Effect probably benign
Transcript: ENSMUST00000200119
SMART Domains Protein: ENSMUSP00000142350
Gene: ENSMUSG00000029592

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:UCH 67 368 2.9e-31 PFAM
Pfam:UCH_1 68 376 1e-14 PFAM
Meta Mutation Damage Score 0.2232 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 85.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Escherichia coli AlkB protein protects against the cytotoxicity of methylating agents by repair of the specific DNA lesions generated in single-stranded DNA. ALKBH2 and ALKBH3 (MIM 610603) are E. coli AlkB homologs that catalyze the removal of 1-methyladenine and 3-methylcytosine (Duncan et al., 2002 [PubMed 12486230]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice are viable and overtly normal but show progressive accumulation of 1-methyladenine (1meA) in their genomic DNA due to impaired DNA repair. Mutant MEFs fail to remove methyl methane sulfate (MMS)-induced 1meA from genomic DNA and showincreased cytotoxicity after MMS exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,262,798 S56R probably damaging Het
Actr8 A G 14: 29,984,099 M99V possibly damaging Het
Adamtsl2 T A 2: 27,103,066 C703S possibly damaging Het
Afap1 G T 5: 35,968,661 K333N probably damaging Het
Aldh3a2 G A 11: 61,264,307 S137L probably damaging Het
Aoc1 A T 6: 48,905,445 K107M possibly damaging Het
Bmp8a G T 4: 123,316,965 S252R possibly damaging Het
C7 T C 15: 5,059,419 I13M probably benign Het
Cblb T A 16: 52,139,611 D322E possibly damaging Het
Cfap54 G A 10: 92,932,721 T180I probably damaging Het
Clrn2 C T 5: 45,460,111 A108V probably damaging Het
Cspg4 T A 9: 56,886,512 D510E probably damaging Het
Cyp2c40 A T 19: 39,777,971 N393K possibly damaging Het
Dcaf5 T C 12: 80,364,069 Y294C probably damaging Het
Dclk3 T A 9: 111,469,020 M544K probably benign Het
Doxl2 A T 6: 48,975,915 Y258F probably damaging Het
Ell3 A T 2: 121,439,465 F388I probably damaging Het
Fam208b T C 13: 3,575,543 K1469R probably benign Het
Fam78b A G 1: 167,078,760 I163V probably damaging Het
Gnptab T C 10: 88,434,081 L882P probably damaging Het
Herc2 A T 7: 56,204,733 D3802V possibly damaging Het
Hs3st5 A G 10: 36,833,414 E315G probably benign Het
Idh3b A T 2: 130,284,054 probably null Het
Lama4 G A 10: 39,073,643 E911K probably damaging Het
Macf1 A G 4: 123,511,007 I436T probably damaging Het
Mgam C A 6: 40,759,780 S871* probably null Het
Mtmr7 A G 8: 40,560,882 S212P probably damaging Het
Mylk2 A G 2: 152,919,416 T480A probably damaging Het
Myo3a A T 2: 22,282,626 N191I probably damaging Het
Nanog C T 6: 122,711,775 S105F probably damaging Het
Nanos2 A G 7: 18,987,639 Y12C probably damaging Het
Nsg1 C T 5: 38,155,643 V71I probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr1458 G T 19: 13,103,204 Y33* probably null Het
Olfr1512 A T 14: 52,372,951 I34N probably damaging Het
Olfr211 T C 6: 116,494,425 L272S probably benign Het
Olfr643 A T 7: 104,058,723 I293N probably damaging Het
Pcdhb17 A G 18: 37,486,648 Q497R probably benign Het
Pcsk7 C A 9: 45,925,986 P536Q probably damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Phyhip A G 14: 70,467,291 K317E probably damaging Het
Pkhd1 C T 1: 20,534,558 G1178R probably damaging Het
Ppp1r9a G A 6: 5,057,557 G544D probably damaging Het
Ptpn3 T C 4: 57,225,775 D480G probably benign Het
Ptprn2 A T 12: 117,253,615 K918N probably damaging Het
Rab42 T C 4: 132,302,347 D188G probably benign Het
Rasgrf2 C A 13: 91,983,676 D20Y probably damaging Het
Ryr2 G A 13: 11,779,266 T942I probably benign Het
Sbpl T C 17: 23,953,354 K197R unknown Het
Slc44a1 T A 4: 53,561,069 V595E probably damaging Het
Slc6a19 A G 13: 73,684,344 M410T probably damaging Het
Sntb1 A T 15: 55,647,955 L411H probably damaging Het
Synj2 A G 17: 6,023,665 K245E probably damaging Het
Tmem131 G A 1: 36,825,478 T558I probably damaging Het
Tnrc18 A T 5: 142,771,533 S1078T unknown Het
Trmu T A 15: 85,897,101 probably null Het
Ttn A T 2: 76,891,086 probably benign Het
Tyw3 T C 3: 154,587,523 T172A probably benign Het
Vldlr T C 19: 27,239,721 I348T possibly damaging Het
Zfp114 A G 7: 24,177,769 D12G probably damaging Het
Other mutations in Alkbh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02298:Alkbh2 APN 5 114125572 missense probably benign
R0326:Alkbh2 UTSW 5 114123950 makesense probably null
R0480:Alkbh2 UTSW 5 114125535 missense probably damaging 1.00
R0962:Alkbh2 UTSW 5 114123953 missense possibly damaging 0.94
R1214:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1215:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1280:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1282:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1309:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1340:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1371:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1445:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1545:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1546:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1629:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1631:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1632:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1707:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1769:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1920:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1921:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1922:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1984:Alkbh2 UTSW 5 114124054 missense probably benign 0.12
R2140:Alkbh2 UTSW 5 114125716 missense probably benign 0.03
R2142:Alkbh2 UTSW 5 114125716 missense probably benign 0.03
R3800:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R3981:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4032:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4062:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4064:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4163:Alkbh2 UTSW 5 114127552 missense probably damaging 1.00
R4569:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4570:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4624:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4625:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4626:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4627:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4628:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4630:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4632:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4633:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4801:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4802:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4803:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCATCATCAGCAGGCTTCCGTG -3'
(R):5'- GACAGGCTTTCGGGCTGTGAAC -3'

Sequencing Primer
(F):5'- AGGCTTCCGTGTGCCAG -3'
(R):5'- acacagacagacagacagac -3'
Posted On2014-03-14