Incidental Mutation 'R1443:Aoc1'
ID158646
Institutional Source Beutler Lab
Gene Symbol Aoc1
Ensembl Gene ENSMUSG00000029811
Gene Nameamine oxidase, copper-containing 1
SynonymsAbp1, 1600012D06Rik
MMRRC Submission 039498-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1443 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location48872896-48909188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48905445 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 107 (K107M)
Ref Sequence ENSEMBL: ENSMUSP00000144764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031835] [ENSMUST00000162948] [ENSMUST00000167529] [ENSMUST00000204856]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031835
AA Change: K85M

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031835
Gene: ENSMUSG00000029811
AA Change: K85M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 8.8e-26 PFAM
Pfam:Cu_amine_oxidN3 146 246 4.1e-20 PFAM
low complexity region 259 274 N/A INTRINSIC
Pfam:Cu_amine_oxid 305 720 6.1e-132 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161184
Predicted Effect possibly damaging
Transcript: ENSMUST00000162948
AA Change: K85M

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124085
Gene: ENSMUSG00000029811
AA Change: K85M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 8.8e-26 PFAM
Pfam:Cu_amine_oxidN3 146 246 4.1e-20 PFAM
low complexity region 259 274 N/A INTRINSIC
Pfam:Cu_amine_oxid 305 720 6.1e-132 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167529
AA Change: K85M

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128816
Gene: ENSMUSG00000029811
AA Change: K85M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 2.4e-30 PFAM
Pfam:Cu_amine_oxidN3 146 246 1.5e-23 PFAM
low complexity region 259 274 N/A INTRINSIC
Pfam:Cu_amine_oxid 305 717 1.5e-123 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204856
AA Change: K107M

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144764
Gene: ENSMUSG00000029811
AA Change: K107M

DomainStartEndE-ValueType
signal peptide 1 49 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 66 152 4.3e-28 PFAM
Pfam:Cu_amine_oxidN3 168 250 8.9e-15 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 85.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metal-binding membrane glycoprotein that oxidatively deaminates putrescine, histamine, and related compounds. The encoded protein is inhibited by amiloride, a diuretic that acts by closing epithelial sodium ion channels. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,262,798 S56R probably damaging Het
Actr8 A G 14: 29,984,099 M99V possibly damaging Het
Adamtsl2 T A 2: 27,103,066 C703S possibly damaging Het
Afap1 G T 5: 35,968,661 K333N probably damaging Het
Aldh3a2 G A 11: 61,264,307 S137L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bmp8a G T 4: 123,316,965 S252R possibly damaging Het
C7 T C 15: 5,059,419 I13M probably benign Het
Cblb T A 16: 52,139,611 D322E possibly damaging Het
Cfap54 G A 10: 92,932,721 T180I probably damaging Het
Clrn2 C T 5: 45,460,111 A108V probably damaging Het
Cspg4 T A 9: 56,886,512 D510E probably damaging Het
Cyp2c40 A T 19: 39,777,971 N393K possibly damaging Het
Dcaf5 T C 12: 80,364,069 Y294C probably damaging Het
Dclk3 T A 9: 111,469,020 M544K probably benign Het
Doxl2 A T 6: 48,975,915 Y258F probably damaging Het
Ell3 A T 2: 121,439,465 F388I probably damaging Het
Fam208b T C 13: 3,575,543 K1469R probably benign Het
Fam78b A G 1: 167,078,760 I163V probably damaging Het
Gnptab T C 10: 88,434,081 L882P probably damaging Het
Herc2 A T 7: 56,204,733 D3802V possibly damaging Het
Hs3st5 A G 10: 36,833,414 E315G probably benign Het
Idh3b A T 2: 130,284,054 probably null Het
Lama4 G A 10: 39,073,643 E911K probably damaging Het
Macf1 A G 4: 123,511,007 I436T probably damaging Het
Mgam C A 6: 40,759,780 S871* probably null Het
Mtmr7 A G 8: 40,560,882 S212P probably damaging Het
Mylk2 A G 2: 152,919,416 T480A probably damaging Het
Myo3a A T 2: 22,282,626 N191I probably damaging Het
Nanog C T 6: 122,711,775 S105F probably damaging Het
Nanos2 A G 7: 18,987,639 Y12C probably damaging Het
Nsg1 C T 5: 38,155,643 V71I probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr1458 G T 19: 13,103,204 Y33* probably null Het
Olfr1512 A T 14: 52,372,951 I34N probably damaging Het
Olfr211 T C 6: 116,494,425 L272S probably benign Het
Olfr643 A T 7: 104,058,723 I293N probably damaging Het
Pcdhb17 A G 18: 37,486,648 Q497R probably benign Het
Pcsk7 C A 9: 45,925,986 P536Q probably damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Phyhip A G 14: 70,467,291 K317E probably damaging Het
Pkhd1 C T 1: 20,534,558 G1178R probably damaging Het
Ppp1r9a G A 6: 5,057,557 G544D probably damaging Het
Ptpn3 T C 4: 57,225,775 D480G probably benign Het
Ptprn2 A T 12: 117,253,615 K918N probably damaging Het
Rab42 T C 4: 132,302,347 D188G probably benign Het
Rasgrf2 C A 13: 91,983,676 D20Y probably damaging Het
Ryr2 G A 13: 11,779,266 T942I probably benign Het
Sbpl T C 17: 23,953,354 K197R unknown Het
Slc44a1 T A 4: 53,561,069 V595E probably damaging Het
Slc6a19 A G 13: 73,684,344 M410T probably damaging Het
Sntb1 A T 15: 55,647,955 L411H probably damaging Het
Synj2 A G 17: 6,023,665 K245E probably damaging Het
Tmem131 G A 1: 36,825,478 T558I probably damaging Het
Tnrc18 A T 5: 142,771,533 S1078T unknown Het
Trmu T A 15: 85,897,101 probably null Het
Ttn A T 2: 76,891,086 probably benign Het
Tyw3 T C 3: 154,587,523 T172A probably benign Het
Vldlr T C 19: 27,239,721 I348T possibly damaging Het
Zfp114 A G 7: 24,177,769 D12G probably damaging Het
Other mutations in Aoc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Aoc1 APN 6 48908664 missense possibly damaging 0.92
IGL01115:Aoc1 APN 6 48906197 missense probably damaging 1.00
IGL01626:Aoc1 APN 6 48906531 missense probably damaging 1.00
IGL01891:Aoc1 APN 6 48908842 unclassified probably benign
IGL01908:Aoc1 APN 6 48906756 missense probably damaging 1.00
IGL01919:Aoc1 APN 6 48908289 missense probably damaging 1.00
IGL01960:Aoc1 APN 6 48908603 missense probably benign 0.00
IGL02102:Aoc1 APN 6 48905962 missense probably damaging 0.99
IGL02121:Aoc1 APN 6 48906320 splice site probably null
IGL02229:Aoc1 APN 6 48905909 nonsense probably null
IGL02325:Aoc1 APN 6 48905895 missense possibly damaging 0.46
IGL02626:Aoc1 APN 6 48906110 missense probably benign 0.04
IGL02737:Aoc1 APN 6 48907643 missense probably benign 0.01
IGL03244:Aoc1 APN 6 48905822 missense possibly damaging 0.79
IGL03371:Aoc1 APN 6 48906446 missense probably benign 0.05
R0100:Aoc1 UTSW 6 48908604 missense possibly damaging 0.92
R0835:Aoc1 UTSW 6 48905514 missense probably damaging 1.00
R1240:Aoc1 UTSW 6 48905615 missense probably benign 0.10
R1400:Aoc1 UTSW 6 48906283 nonsense probably null
R1400:Aoc1 UTSW 6 48906711 missense probably benign
R1447:Aoc1 UTSW 6 48906242 missense probably benign 0.00
R1572:Aoc1 UTSW 6 48905786 missense possibly damaging 0.48
R1850:Aoc1 UTSW 6 48905268 missense probably benign 0.19
R2008:Aoc1 UTSW 6 48905897 missense probably damaging 1.00
R2256:Aoc1 UTSW 6 48906440 missense possibly damaging 0.95
R3429:Aoc1 UTSW 6 48906076 missense probably benign
R3430:Aoc1 UTSW 6 48906076 missense probably benign
R3432:Aoc1 UTSW 6 48905844 missense probably damaging 1.00
R3783:Aoc1 UTSW 6 48905655 missense probably damaging 1.00
R3786:Aoc1 UTSW 6 48905655 missense probably damaging 1.00
R3787:Aoc1 UTSW 6 48905655 missense probably damaging 1.00
R4024:Aoc1 UTSW 6 48908269 missense probably damaging 1.00
R4025:Aoc1 UTSW 6 48908269 missense probably damaging 1.00
R4455:Aoc1 UTSW 6 48905467 missense probably damaging 0.98
R4510:Aoc1 UTSW 6 48907806 missense probably damaging 0.99
R4511:Aoc1 UTSW 6 48907806 missense probably damaging 0.99
R4525:Aoc1 UTSW 6 48906675 missense probably damaging 1.00
R4659:Aoc1 UTSW 6 48906076 missense probably benign
R4876:Aoc1 UTSW 6 48906747 missense possibly damaging 0.78
R5150:Aoc1 UTSW 6 48906150 missense possibly damaging 0.88
R5153:Aoc1 UTSW 6 48908747 missense probably benign 0.19
R5437:Aoc1 UTSW 6 48907750 missense probably benign 0.00
R6000:Aoc1 UTSW 6 48907639 missense probably benign 0.05
R6112:Aoc1 UTSW 6 48908691 missense probably damaging 1.00
R6195:Aoc1 UTSW 6 48908677 missense probably damaging 1.00
R6252:Aoc1 UTSW 6 48906081 missense probably benign 0.01
R6703:Aoc1 UTSW 6 48905714 missense probably damaging 1.00
R6748:Aoc1 UTSW 6 48906294 missense possibly damaging 0.84
R6765:Aoc1 UTSW 6 48905937 missense probably benign 0.00
R6935:Aoc1 UTSW 6 48908227 missense probably damaging 1.00
R7002:Aoc1 UTSW 6 48905876 missense probably benign
R7066:Aoc1 UTSW 6 48908619 missense probably damaging 1.00
R7120:Aoc1 UTSW 6 48906597 missense probably damaging 1.00
R7234:Aoc1 UTSW 6 48905816 nonsense probably null
R7362:Aoc1 UTSW 6 48905411 missense probably benign 0.18
R7452:Aoc1 UTSW 6 48908790 missense probably benign 0.11
R7618:Aoc1 UTSW 6 48906386 missense possibly damaging 0.71
R7773:Aoc1 UTSW 6 48906212 missense probably benign 0.00
R7821:Aoc1 UTSW 6 48905811 missense probably damaging 1.00
R7837:Aoc1 UTSW 6 48905650 nonsense probably null
R8010:Aoc1 UTSW 6 48905648 missense probably benign 0.40
R8517:Aoc1 UTSW 6 48906710 nonsense probably null
X0066:Aoc1 UTSW 6 48908252 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCTGTGACGACTCCTCATGAC -3'
(R):5'- GATAAGCCAGCTTCTACGCTGACC -3'

Sequencing Primer
(F):5'- TGACGACTCCTCATGACAAAGC -3'
(R):5'- TAGAGGAGGTCATACTCCGCTG -3'
Posted On2014-03-14