Mutagenetix > Incidental Mutation

Incidental Mutation 'R1443:Pcsk7'

158655

Institutional Source

Beutler Lab

Gene Symbol

Pcsk7

Ensembl Gene

ENSMUSG00000035382

Gene Name

proprotein convertase subtilisin/kexin type 7

Synonyms

SPC7

MMRRC Submission

039498-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1443 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

45906497-45929726 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 45925986 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 536 (P536Q)

Ref Sequence

ENSEMBL: ENSMUSP00000150393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034590] [ENSMUST00000039059] [ENSMUST00000215189] [ENSMUST00000216672]

AlphaFold

Q61139

Predicted Effect

probably benign
Transcript: ENSMUST00000034590

SMART Domains

Protein: ENSMUSP00000034590
Gene: ENSMUSG00000032085

Domain	Start	End	E-Value	Type
CH	26	133	1.53e-20	SMART
Pfam:Calponin	175	199	5.5e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000039059
AA Change: P536Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000047508
Gene: ENSMUSG00000035382
AA Change: P536Q

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:S8_pro-domain	52	140	9.7e-21	PFAM
Pfam:Peptidase_S8	177	464	4.7e-43	PFAM
Pfam:P_proprotein	524	611	1.3e-27	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213634

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213884

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214425

Predicted Effect

probably benign
Transcript: ENSMUST00000215189

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216035

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216504

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216514

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216614

Predicted Effect

probably damaging
Transcript: ENSMUST00000216672
AA Change: P536Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.2%
20x: 85.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. It encodes a type 1 membrane bound protease that is expressed in many tissues, including neuroendocrine, liver, gut, and brain. The encoded protein undergoes an initial autocatalytic processing event in the ER and then sorts to the trans-Golgi network through endosomes where a second autocatalytic event takes place and the catalytic activity is acquired. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It can process proalbumin and is thought to be responsible for the activation of HIV envelope glycoproteins gp160 and gp140. This gene has been implicated in the transcriptional regulation of housekeeping genes and plays a role in the regulation of iron metabolism. A t(11;14)(q23;q32) chromosome translocation associated with B-cell lymphoma occurs between this gene and its inverted counterpart. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to LPS. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,262,798	S56R	probably damaging	Het
Actr8	A	G	14: 29,984,099	M99V	possibly damaging	Het
Adamtsl2	T	A	2: 27,103,066	C703S	possibly damaging	Het
Afap1	G	T	5: 35,968,661	K333N	probably damaging	Het
Aldh3a2	G	A	11: 61,264,307	S137L	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Aoc1	A	T	6: 48,905,445	K107M	possibly damaging	Het
Bmp8a	G	T	4: 123,316,965	S252R	possibly damaging	Het
C7	T	C	15: 5,059,419	I13M	probably benign	Het
Cblb	T	A	16: 52,139,611	D322E	possibly damaging	Het
Cfap54	G	A	10: 92,932,721	T180I	probably damaging	Het
Clrn2	C	T	5: 45,460,111	A108V	probably damaging	Het
Cspg4	T	A	9: 56,886,512	D510E	probably damaging	Het
Cyp2c40	A	T	19: 39,777,971	N393K	possibly damaging	Het
Dcaf5	T	C	12: 80,364,069	Y294C	probably damaging	Het
Dclk3	T	A	9: 111,469,020	M544K	probably benign	Het
Doxl2	A	T	6: 48,975,915	Y258F	probably damaging	Het
Ell3	A	T	2: 121,439,465	F388I	probably damaging	Het
Fam208b	T	C	13: 3,575,543	K1469R	probably benign	Het
Fam78b	A	G	1: 167,078,760	I163V	probably damaging	Het
Gnptab	T	C	10: 88,434,081	L882P	probably damaging	Het
Herc2	A	T	7: 56,204,733	D3802V	possibly damaging	Het
Hs3st5	A	G	10: 36,833,414	E315G	probably benign	Het
Idh3b	A	T	2: 130,284,054		probably null	Het
Lama4	G	A	10: 39,073,643	E911K	probably damaging	Het
Macf1	A	G	4: 123,511,007	I436T	probably damaging	Het
Mgam	C	A	6: 40,759,780	S871*	probably null	Het
Mtmr7	A	G	8: 40,560,882	S212P	probably damaging	Het
Mylk2	A	G	2: 152,919,416	T480A	probably damaging	Het
Myo3a	A	T	2: 22,282,626	N191I	probably damaging	Het
Nanog	C	T	6: 122,711,775	S105F	probably damaging	Het
Nanos2	A	G	7: 18,987,639	Y12C	probably damaging	Het
Nsg1	C	T	5: 38,155,643	V71I	probably benign	Het
Olfr1368	C	T	13: 21,142,167	V297I	probably benign	Het
Olfr1458	G	T	19: 13,103,204	Y33*	probably null	Het
Olfr1512	A	T	14: 52,372,951	I34N	probably damaging	Het
Olfr211	T	C	6: 116,494,425	L272S	probably benign	Het
Olfr643	A	T	7: 104,058,723	I293N	probably damaging	Het
Pcdhb17	A	G	18: 37,486,648	Q497R	probably benign	Het
Phactr4	G	A	4: 132,377,248	T256I	probably benign	Het
Phyhip	A	G	14: 70,467,291	K317E	probably damaging	Het
Pkhd1	C	T	1: 20,534,558	G1178R	probably damaging	Het
Ppp1r9a	G	A	6: 5,057,557	G544D	probably damaging	Het
Ptpn3	T	C	4: 57,225,775	D480G	probably benign	Het
Ptprn2	A	T	12: 117,253,615	K918N	probably damaging	Het
Rab42	T	C	4: 132,302,347	D188G	probably benign	Het
Rasgrf2	C	A	13: 91,983,676	D20Y	probably damaging	Het
Ryr2	G	A	13: 11,779,266	T942I	probably benign	Het
Sbpl	T	C	17: 23,953,354	K197R	unknown	Het
Slc44a1	T	A	4: 53,561,069	V595E	probably damaging	Het
Slc6a19	A	G	13: 73,684,344	M410T	probably damaging	Het
Sntb1	A	T	15: 55,647,955	L411H	probably damaging	Het
Synj2	A	G	17: 6,023,665	K245E	probably damaging	Het
Tmem131	G	A	1: 36,825,478	T558I	probably damaging	Het
Tnrc18	A	T	5: 142,771,533	S1078T	unknown	Het
Trmu	T	A	15: 85,897,101		probably null	Het
Ttn	A	T	2: 76,891,086		probably benign	Het
Tyw3	T	C	3: 154,587,523	T172A	probably benign	Het
Vldlr	T	C	19: 27,239,721	I348T	possibly damaging	Het
Zfp114	A	G	7: 24,177,769	D12G	probably damaging	Het

Other mutations in Pcsk7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Pcsk7	APN	9	45927660	missense	probably benign
IGL01081:Pcsk7	APN	9	45928707	missense	probably benign
IGL02634:Pcsk7	APN	9	45919262	missense	possibly damaging	0.87
IGL02999:Pcsk7	APN	9	45927599	missense	possibly damaging	0.68
IGL03115:Pcsk7	APN	9	45914372	missense	probably damaging	1.00
IGL03149:Pcsk7	APN	9	45909480	missense	probably benign	0.37
R0243:Pcsk7	UTSW	9	45916059	missense	probably damaging	1.00
R0324:Pcsk7	UTSW	9	45913011	missense	possibly damaging	0.87
R0947:Pcsk7	UTSW	9	45911172	missense	probably damaging	1.00
R1545:Pcsk7	UTSW	9	45914348	missense	probably damaging	1.00
R2182:Pcsk7	UTSW	9	45928619	missense	probably benign
R2939:Pcsk7	UTSW	9	45916024	missense	probably damaging	1.00
R3739:Pcsk7	UTSW	9	45926759	missense	possibly damaging	0.72
R4039:Pcsk7	UTSW	9	45928007	splice site	probably null
R4348:Pcsk7	UTSW	9	45919348	missense	probably damaging	1.00
R4974:Pcsk7	UTSW	9	45918862	missense	probably damaging	1.00
R5817:Pcsk7	UTSW	9	45926033	missense	probably benign	0.01
R6214:Pcsk7	UTSW	9	45910376	missense	possibly damaging	0.47
R6215:Pcsk7	UTSW	9	45910376	missense	possibly damaging	0.47
R6408:Pcsk7	UTSW	9	45909696	missense	probably benign	0.18
R7338:Pcsk7	UTSW	9	45925989	missense	probably benign	0.03
R7355:Pcsk7	UTSW	9	45909374	missense	probably benign	0.03
R7475:Pcsk7	UTSW	9	45927625	missense	probably damaging	1.00
R7540:Pcsk7	UTSW	9	45927673	splice site	probably null
R8305:Pcsk7	UTSW	9	45910409	missense	probably damaging	1.00
R8834:Pcsk7	UTSW	9	45919291	missense	possibly damaging	0.70
R8973:Pcsk7	UTSW	9	45927642	missense	probably benign	0.22
R9541:Pcsk7	UTSW	9	45909470	missense	probably benign	0.00
R9571:Pcsk7	UTSW	9	45909609	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- GTGCCTCAACTCATCTGATATGCCC -3'
(R):5'- TGGCTTCTAGCTGCTAAAGACAACC -3'

Sequencing Primer
(F):5'- tgcacttacttctctttgtattctc -3'
(R):5'- CCAGTGGAAGGCTTCAGTATC -3'

Posted On

2014-03-14