Incidental Mutation 'R1443:Ptprn2'
ID 158666
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Name protein tyrosine phosphatase receptor type N polypeptide 2
Synonyms IA-2 beta, PTP-NP, 4930425H11Rik, IA-2beta, phogrin
MMRRC Submission 039498-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.170) question?
Stock # R1443 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 116449340-117240469 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 117217235 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 918 (K918N)
Ref Sequence ENSEMBL: ENSMUSP00000139978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
AlphaFold P80560
Predicted Effect probably damaging
Transcript: ENSMUST00000070733
AA Change: K918N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: K918N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190132
Predicted Effect probably damaging
Transcript: ENSMUST00000190247
AA Change: K918N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: K918N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 85.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 A G 14: 29,706,056 (GRCm39) M99V possibly damaging Het
Adamtsl2 T A 2: 26,993,078 (GRCm39) C703S possibly damaging Het
Afap1 G T 5: 36,126,005 (GRCm39) K333N probably damaging Het
Aldh3a2 G A 11: 61,155,133 (GRCm39) S137L probably damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Aoc1 A T 6: 48,882,379 (GRCm39) K107M possibly damaging Het
Aoc1l1 A T 6: 48,952,849 (GRCm39) Y258F probably damaging Het
Bltp2 T A 11: 78,153,624 (GRCm39) S56R probably damaging Het
Bmp8a G T 4: 123,210,758 (GRCm39) S252R possibly damaging Het
C7 T C 15: 5,088,901 (GRCm39) I13M probably benign Het
Cblb T A 16: 51,959,974 (GRCm39) D322E possibly damaging Het
Cfap54 G A 10: 92,768,583 (GRCm39) T180I probably damaging Het
Clrn2 C T 5: 45,617,453 (GRCm39) A108V probably damaging Het
Cspg4 T A 9: 56,793,796 (GRCm39) D510E probably damaging Het
Cyp2c40 A T 19: 39,766,415 (GRCm39) N393K possibly damaging Het
Dcaf5 T C 12: 80,410,843 (GRCm39) Y294C probably damaging Het
Dclk3 T A 9: 111,298,088 (GRCm39) M544K probably benign Het
Ell3 A T 2: 121,269,946 (GRCm39) F388I probably damaging Het
Fam78b A G 1: 166,906,329 (GRCm39) I163V probably damaging Het
Gnptab T C 10: 88,269,943 (GRCm39) L882P probably damaging Het
Herc2 A T 7: 55,854,481 (GRCm39) D3802V possibly damaging Het
Hs3st5 A G 10: 36,709,410 (GRCm39) E315G probably benign Het
Idh3b A T 2: 130,125,974 (GRCm39) probably null Het
Lama4 G A 10: 38,949,639 (GRCm39) E911K probably damaging Het
Macf1 A G 4: 123,404,800 (GRCm39) I436T probably damaging Het
Mgam C A 6: 40,736,714 (GRCm39) S871* probably null Het
Mtmr7 A G 8: 41,013,923 (GRCm39) S212P probably damaging Het
Mylk2 A G 2: 152,761,336 (GRCm39) T480A probably damaging Het
Myo3a A T 2: 22,287,437 (GRCm39) N191I probably damaging Het
Nanog C T 6: 122,688,734 (GRCm39) S105F probably damaging Het
Nanos2 A G 7: 18,721,564 (GRCm39) Y12C probably damaging Het
Nsg1 C T 5: 38,312,987 (GRCm39) V71I probably benign Het
Or10g3 A T 14: 52,610,408 (GRCm39) I34N probably damaging Het
Or13a1 T C 6: 116,471,386 (GRCm39) L272S probably benign Het
Or2ad1 C T 13: 21,326,337 (GRCm39) V297I probably benign Het
Or51a42 A T 7: 103,707,930 (GRCm39) I293N probably damaging Het
Or5b105 G T 19: 13,080,568 (GRCm39) Y33* probably null Het
Pcdhb17 A G 18: 37,619,701 (GRCm39) Q497R probably benign Het
Pcsk7 C A 9: 45,837,284 (GRCm39) P536Q probably damaging Het
Phactr4 G A 4: 132,104,559 (GRCm39) T256I probably benign Het
Phyhip A G 14: 70,704,731 (GRCm39) K317E probably damaging Het
Pkhd1 C T 1: 20,604,782 (GRCm39) G1178R probably damaging Het
Ppp1r9a G A 6: 5,057,557 (GRCm39) G544D probably damaging Het
Ptpn3 T C 4: 57,225,775 (GRCm39) D480G probably benign Het
Rab42 T C 4: 132,029,658 (GRCm39) D188G probably benign Het
Rasgrf2 C A 13: 92,131,795 (GRCm39) D20Y probably damaging Het
Ryr2 G A 13: 11,794,152 (GRCm39) T942I probably benign Het
Sbpl T C 17: 24,172,328 (GRCm39) K197R unknown Het
Slc44a1 T A 4: 53,561,069 (GRCm39) V595E probably damaging Het
Slc6a19 A G 13: 73,832,463 (GRCm39) M410T probably damaging Het
Sntb1 A T 15: 55,511,351 (GRCm39) L411H probably damaging Het
Synj2 A G 17: 6,073,940 (GRCm39) K245E probably damaging Het
Tasor2 T C 13: 3,625,543 (GRCm39) K1469R probably benign Het
Tmem131 G A 1: 36,864,559 (GRCm39) T558I probably damaging Het
Tnrc18 A T 5: 142,757,288 (GRCm39) S1078T unknown Het
Trmu T A 15: 85,781,302 (GRCm39) probably null Het
Ttn A T 2: 76,721,430 (GRCm39) probably benign Het
Tyw3 T C 3: 154,293,160 (GRCm39) T172A probably benign Het
Vldlr T C 19: 27,217,121 (GRCm39) I348T possibly damaging Het
Zfp114 A G 7: 23,877,194 (GRCm39) D12G probably damaging Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116,805,008 (GRCm39) missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116,864,607 (GRCm39) missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116,837,317 (GRCm39) splice site probably benign
IGL02339:Ptprn2 APN 12 116,685,724 (GRCm39) missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116,852,518 (GRCm39) missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117,175,563 (GRCm39) missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116,839,964 (GRCm39) nonsense probably null
BB001:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
BB011:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
IGL03014:Ptprn2 UTSW 12 117,212,308 (GRCm39) missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0694:Ptprn2 UTSW 12 116,787,975 (GRCm39) missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116,685,750 (GRCm39) nonsense probably null
R0746:Ptprn2 UTSW 12 116,864,637 (GRCm39) missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117,175,628 (GRCm39) splice site probably null
R1508:Ptprn2 UTSW 12 117,148,342 (GRCm39) missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117,125,329 (GRCm39) missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116,685,792 (GRCm39) missense possibly damaging 0.64
R1749:Ptprn2 UTSW 12 116,544,048 (GRCm39) missense probably benign 0.00
R2075:Ptprn2 UTSW 12 117,211,337 (GRCm39) missense probably benign 0.01
R3054:Ptprn2 UTSW 12 116,685,753 (GRCm39) missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116,852,497 (GRCm39) missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116,864,628 (GRCm39) missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116,839,620 (GRCm39) missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116,835,714 (GRCm39) missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116,788,016 (GRCm39) missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117,211,393 (GRCm39) nonsense probably null
R4872:Ptprn2 UTSW 12 117,125,314 (GRCm39) missense probably damaging 1.00
R4891:Ptprn2 UTSW 12 117,196,985 (GRCm39) splice site probably null
R4970:Ptprn2 UTSW 12 117,240,215 (GRCm39) missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116,822,548 (GRCm39) missense probably damaging 1.00
R5287:Ptprn2 UTSW 12 117,175,482 (GRCm39) missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117,148,267 (GRCm39) missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116,822,739 (GRCm39) missense probably benign 0.05
R6277:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117,233,209 (GRCm39) missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116,835,658 (GRCm39) missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117,190,820 (GRCm39) missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116,852,508 (GRCm39) missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116,835,676 (GRCm39) missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117,190,845 (GRCm39) splice site probably null
R7237:Ptprn2 UTSW 12 117,125,347 (GRCm39) missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117,212,164 (GRCm39) missense probably damaging 1.00
R7355:Ptprn2 UTSW 12 116,822,571 (GRCm39) missense probably benign
R7460:Ptprn2 UTSW 12 117,212,301 (GRCm39) missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116,449,486 (GRCm39) start codon destroyed probably null
R7658:Ptprn2 UTSW 12 116,685,739 (GRCm39) missense probably benign 0.01
R7666:Ptprn2 UTSW 12 116,804,940 (GRCm39) missense probably benign 0.10
R7924:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
R8219:Ptprn2 UTSW 12 117,148,357 (GRCm39) missense probably benign 0.30
R8716:Ptprn2 UTSW 12 117,219,168 (GRCm39) missense possibly damaging 0.73
R9235:Ptprn2 UTSW 12 117,233,271 (GRCm39) critical splice donor site probably null
R9605:Ptprn2 UTSW 12 117,125,278 (GRCm39) missense probably benign 0.13
X0066:Ptprn2 UTSW 12 117,148,360 (GRCm39) missense probably benign 0.16
X0066:Ptprn2 UTSW 12 117,125,380 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCGTTGACTGAGTTGCCATTG -3'
(R):5'- ATTTGGAAGTAGAAGACAGCCCGTG -3'

Sequencing Primer
(F):5'- TGACTGAGTTGCCATTGAAAGG -3'
(R):5'- CTATTTAGTCCATGTGCAAAGGC -3'
Posted On 2014-03-14