Mutagenetix > Incidental Mutation

Incidental Mutation 'R1443:Olfr1368'

158669

Institutional Source

Beutler Lab

Gene Symbol

Olfr1368

Ensembl Gene

ENSMUSG00000045474

Gene Name

olfactory receptor 1368

Synonyms

MOR256-15, GA_x6K02T2QHY8-12104556-12105500

MMRRC Submission

039498-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.067) question?

Stock #

R1443 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21141882-21145867 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 21142167 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 297 (V297I)

Ref Sequence

ENSEMBL: ENSMUSP00000149549 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055298] [ENSMUST00000216039]

AlphaFold

Q8VFG3

Predicted Effect

probably benign
Transcript: ENSMUST00000055298
AA Change: V297I

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000050942
Gene: ENSMUSG00000045474
AA Change: V297I

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	4.8e-49	PFAM
Pfam:7tm_1	41	290	1.6e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206267

Predicted Effect

probably benign
Transcript: ENSMUST00000216039
AA Change: V297I

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.2%
20x: 85.7%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,262,798	S56R	probably damaging	Het
Actr8	A	G	14: 29,984,099	M99V	possibly damaging	Het
Adamtsl2	T	A	2: 27,103,066	C703S	possibly damaging	Het
Afap1	G	T	5: 35,968,661	K333N	probably damaging	Het
Aldh3a2	G	A	11: 61,264,307	S137L	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Aoc1	A	T	6: 48,905,445	K107M	possibly damaging	Het
Bmp8a	G	T	4: 123,316,965	S252R	possibly damaging	Het
C7	T	C	15: 5,059,419	I13M	probably benign	Het
Cblb	T	A	16: 52,139,611	D322E	possibly damaging	Het
Cfap54	G	A	10: 92,932,721	T180I	probably damaging	Het
Clrn2	C	T	5: 45,460,111	A108V	probably damaging	Het
Cspg4	T	A	9: 56,886,512	D510E	probably damaging	Het
Cyp2c40	A	T	19: 39,777,971	N393K	possibly damaging	Het
Dcaf5	T	C	12: 80,364,069	Y294C	probably damaging	Het
Dclk3	T	A	9: 111,469,020	M544K	probably benign	Het
Doxl2	A	T	6: 48,975,915	Y258F	probably damaging	Het
Ell3	A	T	2: 121,439,465	F388I	probably damaging	Het
Fam208b	T	C	13: 3,575,543	K1469R	probably benign	Het
Fam78b	A	G	1: 167,078,760	I163V	probably damaging	Het
Gnptab	T	C	10: 88,434,081	L882P	probably damaging	Het
Herc2	A	T	7: 56,204,733	D3802V	possibly damaging	Het
Hs3st5	A	G	10: 36,833,414	E315G	probably benign	Het
Idh3b	A	T	2: 130,284,054		probably null	Het
Lama4	G	A	10: 39,073,643	E911K	probably damaging	Het
Macf1	A	G	4: 123,511,007	I436T	probably damaging	Het
Mgam	C	A	6: 40,759,780	S871*	probably null	Het
Mtmr7	A	G	8: 40,560,882	S212P	probably damaging	Het
Mylk2	A	G	2: 152,919,416	T480A	probably damaging	Het
Myo3a	A	T	2: 22,282,626	N191I	probably damaging	Het
Nanog	C	T	6: 122,711,775	S105F	probably damaging	Het
Nanos2	A	G	7: 18,987,639	Y12C	probably damaging	Het
Nsg1	C	T	5: 38,155,643	V71I	probably benign	Het
Olfr1458	G	T	19: 13,103,204	Y33*	probably null	Het
Olfr1512	A	T	14: 52,372,951	I34N	probably damaging	Het
Olfr211	T	C	6: 116,494,425	L272S	probably benign	Het
Olfr643	A	T	7: 104,058,723	I293N	probably damaging	Het
Pcdhb17	A	G	18: 37,486,648	Q497R	probably benign	Het
Pcsk7	C	A	9: 45,925,986	P536Q	probably damaging	Het
Phactr4	G	A	4: 132,377,248	T256I	probably benign	Het
Phyhip	A	G	14: 70,467,291	K317E	probably damaging	Het
Pkhd1	C	T	1: 20,534,558	G1178R	probably damaging	Het
Ppp1r9a	G	A	6: 5,057,557	G544D	probably damaging	Het
Ptpn3	T	C	4: 57,225,775	D480G	probably benign	Het
Ptprn2	A	T	12: 117,253,615	K918N	probably damaging	Het
Rab42	T	C	4: 132,302,347	D188G	probably benign	Het
Rasgrf2	C	A	13: 91,983,676	D20Y	probably damaging	Het
Ryr2	G	A	13: 11,779,266	T942I	probably benign	Het
Sbpl	T	C	17: 23,953,354	K197R	unknown	Het
Slc44a1	T	A	4: 53,561,069	V595E	probably damaging	Het
Slc6a19	A	G	13: 73,684,344	M410T	probably damaging	Het
Sntb1	A	T	15: 55,647,955	L411H	probably damaging	Het
Synj2	A	G	17: 6,023,665	K245E	probably damaging	Het
Tmem131	G	A	1: 36,825,478	T558I	probably damaging	Het
Tnrc18	A	T	5: 142,771,533	S1078T	unknown	Het
Trmu	T	A	15: 85,897,101		probably null	Het
Ttn	A	T	2: 76,891,086		probably benign	Het
Tyw3	T	C	3: 154,587,523	T172A	probably benign	Het
Vldlr	T	C	19: 27,239,721	I348T	possibly damaging	Het
Zfp114	A	G	7: 24,177,769	D12G	probably damaging	Het

Other mutations in Olfr1368

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03354:Olfr1368	APN	13	21142484	missense	probably damaging	1.00
IGL03385:Olfr1368	APN	13	21142487	missense	probably benign	0.01
R0137:Olfr1368	UTSW	13	21142166	missense	possibly damaging	0.86
R1168:Olfr1368	UTSW	13	21142617	missense	probably benign	0.04
R1212:Olfr1368	UTSW	13	21142167	missense	probably benign	0.16
R1214:Olfr1368	UTSW	13	21142167	missense	probably benign	0.16
R1237:Olfr1368	UTSW	13	21142167	missense	probably benign	0.16
R1238:Olfr1368	UTSW	13	21142167	missense	probably benign	0.16
R1239:Olfr1368	UTSW	13	21142167	missense	probably benign	0.16
R1280:Olfr1368	UTSW	13	21142167	missense	probably benign	0.16
R1309:Olfr1368	UTSW	13	21142167	missense	probably benign	0.16
R1436:Olfr1368	UTSW	13	21142992	missense	probably benign	0.01
R1444:Olfr1368	UTSW	13	21142167	missense	probably benign	0.16
R1602:Olfr1368	UTSW	13	21142650	missense	probably damaging	0.99
R1627:Olfr1368	UTSW	13	21142955	missense	probably damaging	0.99
R1649:Olfr1368	UTSW	13	21142742	missense	probably damaging	1.00
R1781:Olfr1368	UTSW	13	21142764	missense	probably benign	0.08
R1858:Olfr1368	UTSW	13	21142394	missense	probably damaging	1.00
R2520:Olfr1368	UTSW	13	21142576	nonsense	probably null
R4873:Olfr1368	UTSW	13	21142280	missense	probably damaging	1.00
R4875:Olfr1368	UTSW	13	21142280	missense	probably damaging	1.00
R5009:Olfr1368	UTSW	13	21142265	missense	probably benign	0.01
R6222:Olfr1368	UTSW	13	21142877	missense	probably damaging	1.00
R7031:Olfr1368	UTSW	13	21143000	missense	probably benign
R7126:Olfr1368	UTSW	13	21142718	missense	probably damaging	1.00
R7691:Olfr1368	UTSW	13	21142970	missense	probably benign
R7875:Olfr1368	UTSW	13	21142923	missense	probably damaging	1.00
R7966:Olfr1368	UTSW	13	21142186	nonsense	probably null
R8015:Olfr1368	UTSW	13	21142133	missense	probably benign
R8155:Olfr1368	UTSW	13	21142892	missense	probably damaging	1.00
R8247:Olfr1368	UTSW	13	21142125	missense	probably benign
R8787:Olfr1368	UTSW	13	21142283	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- ATGCCAGGGAAATGGTCCTGAATG -3'
(R):5'- ACCCTGTGCTTTGCCAGAAGATG -3'

Sequencing Primer
(F):5'- ATGGTCCTGAATGAACTGATCTGC -3'
(R):5'- GCAGTTATCACTCAAGCTGTG -3'

Posted On

2014-03-14