Mutagenetix > Incidental Mutation

Incidental Mutation 'R1443:Rasgrf2'

158671

Institutional Source

Beutler Lab

Gene Symbol

Rasgrf2

Ensembl Gene

ENSMUSG00000021708

Gene Name

RAS protein-specific guanine nucleotide-releasing factor 2

Synonyms

Grf2, 6330417G04Rik

MMRRC Submission

039498-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.184) question?

Stock #

R1443 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

91880400-92131656 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 91983676 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 20 (D20Y)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099326]

AlphaFold

P70392

Predicted Effect

probably damaging
Transcript: ENSMUST00000099326
AA Change: D621Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: D621Y

Domain	Start	End	E-Value	Type
PH	23	135	1.29e-16	SMART
IQ	204	226	1.3e0	SMART
RhoGEF	247	428	2.2e-51	SMART
RasGEFN	633	775	9.35e-15	SMART
RasGEFN	786	923	6.04e-9	SMART
RasGEF	949	1186	2.97e-112	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000142378
AA Change: D20Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115401
Gene: ENSMUSG00000021708
AA Change: D20Y

Domain	Start	End	E-Value	Type
RasGEFN	33	175	9.35e-15	SMART
Blast:RasGEFN	187	249	8e-29	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000151408
AA Change: D20Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000116892
Gene: ENSMUSG00000021708
AA Change: D20Y

Domain	Start	End	E-Value	Type
RasGEFN	33	175	9.35e-15	SMART
RasGEFN	186	323	6.04e-9	SMART
RasGEF	349	586	2.97e-112	SMART

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.2%
20x: 85.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,262,798	S56R	probably damaging	Het
Actr8	A	G	14: 29,984,099	M99V	possibly damaging	Het
Adamtsl2	T	A	2: 27,103,066	C703S	possibly damaging	Het
Afap1	G	T	5: 35,968,661	K333N	probably damaging	Het
Aldh3a2	G	A	11: 61,264,307	S137L	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Aoc1	A	T	6: 48,905,445	K107M	possibly damaging	Het
Bmp8a	G	T	4: 123,316,965	S252R	possibly damaging	Het
C7	T	C	15: 5,059,419	I13M	probably benign	Het
Cblb	T	A	16: 52,139,611	D322E	possibly damaging	Het
Cfap54	G	A	10: 92,932,721	T180I	probably damaging	Het
Clrn2	C	T	5: 45,460,111	A108V	probably damaging	Het
Cspg4	T	A	9: 56,886,512	D510E	probably damaging	Het
Cyp2c40	A	T	19: 39,777,971	N393K	possibly damaging	Het
Dcaf5	T	C	12: 80,364,069	Y294C	probably damaging	Het
Dclk3	T	A	9: 111,469,020	M544K	probably benign	Het
Doxl2	A	T	6: 48,975,915	Y258F	probably damaging	Het
Ell3	A	T	2: 121,439,465	F388I	probably damaging	Het
Fam208b	T	C	13: 3,575,543	K1469R	probably benign	Het
Fam78b	A	G	1: 167,078,760	I163V	probably damaging	Het
Gnptab	T	C	10: 88,434,081	L882P	probably damaging	Het
Herc2	A	T	7: 56,204,733	D3802V	possibly damaging	Het
Hs3st5	A	G	10: 36,833,414	E315G	probably benign	Het
Idh3b	A	T	2: 130,284,054		probably null	Het
Lama4	G	A	10: 39,073,643	E911K	probably damaging	Het
Macf1	A	G	4: 123,511,007	I436T	probably damaging	Het
Mgam	C	A	6: 40,759,780	S871*	probably null	Het
Mtmr7	A	G	8: 40,560,882	S212P	probably damaging	Het
Mylk2	A	G	2: 152,919,416	T480A	probably damaging	Het
Myo3a	A	T	2: 22,282,626	N191I	probably damaging	Het
Nanog	C	T	6: 122,711,775	S105F	probably damaging	Het
Nanos2	A	G	7: 18,987,639	Y12C	probably damaging	Het
Nsg1	C	T	5: 38,155,643	V71I	probably benign	Het
Olfr1368	C	T	13: 21,142,167	V297I	probably benign	Het
Olfr1458	G	T	19: 13,103,204	Y33*	probably null	Het
Olfr1512	A	T	14: 52,372,951	I34N	probably damaging	Het
Olfr211	T	C	6: 116,494,425	L272S	probably benign	Het
Olfr643	A	T	7: 104,058,723	I293N	probably damaging	Het
Pcdhb17	A	G	18: 37,486,648	Q497R	probably benign	Het
Pcsk7	C	A	9: 45,925,986	P536Q	probably damaging	Het
Phactr4	G	A	4: 132,377,248	T256I	probably benign	Het
Phyhip	A	G	14: 70,467,291	K317E	probably damaging	Het
Pkhd1	C	T	1: 20,534,558	G1178R	probably damaging	Het
Ppp1r9a	G	A	6: 5,057,557	G544D	probably damaging	Het
Ptpn3	T	C	4: 57,225,775	D480G	probably benign	Het
Ptprn2	A	T	12: 117,253,615	K918N	probably damaging	Het
Rab42	T	C	4: 132,302,347	D188G	probably benign	Het
Ryr2	G	A	13: 11,779,266	T942I	probably benign	Het
Sbpl	T	C	17: 23,953,354	K197R	unknown	Het
Slc44a1	T	A	4: 53,561,069	V595E	probably damaging	Het
Slc6a19	A	G	13: 73,684,344	M410T	probably damaging	Het
Sntb1	A	T	15: 55,647,955	L411H	probably damaging	Het
Synj2	A	G	17: 6,023,665	K245E	probably damaging	Het
Tmem131	G	A	1: 36,825,478	T558I	probably damaging	Het
Tnrc18	A	T	5: 142,771,533	S1078T	unknown	Het
Trmu	T	A	15: 85,897,101		probably null	Het
Ttn	A	T	2: 76,891,086		probably benign	Het
Tyw3	T	C	3: 154,587,523	T172A	probably benign	Het
Vldlr	T	C	19: 27,239,721	I348T	possibly damaging	Het
Zfp114	A	G	7: 24,177,769	D12G	probably damaging	Het

Other mutations in Rasgrf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Rasgrf2	APN	13	92022917	splice site	probably benign
IGL01358:Rasgrf2	APN	13	91982630	missense	probably benign	0.23
IGL01666:Rasgrf2	APN	13	92038210	missense	probably damaging	1.00
IGL01930:Rasgrf2	APN	13	91982738	missense	probably damaging	0.98
IGL02230:Rasgrf2	APN	13	91988026	missense	probably damaging	1.00
IGL02630:Rasgrf2	APN	13	92131392	missense	probably damaging	1.00
IGL02690:Rasgrf2	APN	13	92030765	missense	probably damaging	1.00
IGL02943:Rasgrf2	APN	13	91983633	missense	probably damaging	1.00
IGL03067:Rasgrf2	APN	13	92022905	missense	probably damaging	0.97
IGL03342:Rasgrf2	APN	13	91987979	missense	probably damaging	1.00
IGL03405:Rasgrf2	APN	13	91896051	missense	probably damaging	1.00
R0620:Rasgrf2	UTSW	13	91919817	splice site	probably benign
R0632:Rasgrf2	UTSW	13	91972274	missense	probably benign	0.00
R0894:Rasgrf2	UTSW	13	91982771	missense	probably damaging	1.00
R1354:Rasgrf2	UTSW	13	92028666	missense	probably damaging	1.00
R1400:Rasgrf2	UTSW	13	91887689	missense	probably damaging	1.00
R1437:Rasgrf2	UTSW	13	92030888	missense	probably damaging	1.00
R1522:Rasgrf2	UTSW	13	91896086	missense	probably benign	0.00
R1553:Rasgrf2	UTSW	13	91890664	missense	probably damaging	1.00
R1613:Rasgrf2	UTSW	13	91902621	missense	probably damaging	1.00
R1883:Rasgrf2	UTSW	13	91969030	missense	probably benign
R1934:Rasgrf2	UTSW	13	91983706	splice site	probably null
R1990:Rasgrf2	UTSW	13	92035965	missense	probably damaging	1.00
R2037:Rasgrf2	UTSW	13	91902629	missense	probably damaging	0.99
R2043:Rasgrf2	UTSW	13	92030843	missense	possibly damaging	0.91
R2135:Rasgrf2	UTSW	13	91972255	missense	probably benign
R2193:Rasgrf2	UTSW	13	92023713	splice site	probably null
R2406:Rasgrf2	UTSW	13	91972240	missense	probably benign
R3055:Rasgrf2	UTSW	13	92029075	missense	probably damaging	1.00
R3916:Rasgrf2	UTSW	13	92030788	missense	probably damaging	1.00
R3954:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R3955:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R3956:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R4133:Rasgrf2	UTSW	13	91982654	missense	possibly damaging	0.59
R4177:Rasgrf2	UTSW	13	91890598	missense	probably damaging	1.00
R4178:Rasgrf2	UTSW	13	91890598	missense	probably damaging	1.00
R4357:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4358:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4359:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4439:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4440:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4441:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4564:Rasgrf2	UTSW	13	91885654	nonsense	probably null
R4576:Rasgrf2	UTSW	13	91896410	missense	possibly damaging	0.58
R4590:Rasgrf2	UTSW	13	92038281	missense	probably damaging	1.00
R4718:Rasgrf2	UTSW	13	91990830	critical splice donor site	probably null
R4778:Rasgrf2	UTSW	13	91983661	missense	probably damaging	0.99
R4790:Rasgrf2	UTSW	13	91988016	missense	probably damaging	1.00
R4808:Rasgrf2	UTSW	13	92023682	missense	probably damaging	1.00
R5151:Rasgrf2	UTSW	13	91896036	missense	probably damaging	1.00
R5286:Rasgrf2	UTSW	13	92131433	missense	possibly damaging	0.94
R5902:Rasgrf2	UTSW	13	91919892	missense	probably damaging	1.00
R6180:Rasgrf2	UTSW	13	92029101	missense	probably damaging	1.00
R6264:Rasgrf2	UTSW	13	92030785	missense	probably damaging	1.00
R6369:Rasgrf2	UTSW	13	92131446	missense	probably benign
R6428:Rasgrf2	UTSW	13	91987981	missense	probably damaging	1.00
R6595:Rasgrf2	UTSW	13	92030853	missense	probably damaging	1.00
R6619:Rasgrf2	UTSW	13	92028519	missense	probably damaging	1.00
R6988:Rasgrf2	UTSW	13	91885635	missense	probably benign	0.02
R7026:Rasgrf2	UTSW	13	91983613	missense	probably damaging	1.00
R7038:Rasgrf2	UTSW	13	91982833	missense	possibly damaging	0.95
R7045:Rasgrf2	UTSW	13	92022592	intron	probably benign
R7056:Rasgrf2	UTSW	13	92030695	missense	probably damaging	0.99
R7058:Rasgrf2	UTSW	13	91886402	missense	probably damaging	0.99
R7256:Rasgrf2	UTSW	13	91884518	nonsense	probably null
R7392:Rasgrf2	UTSW	13	91893737	missense
R7469:Rasgrf2	UTSW	13	92029022	critical splice donor site	probably null
R7618:Rasgrf2	UTSW	13	91987966	missense
R7641:Rasgrf2	UTSW	13	92131406	missense	possibly damaging	0.65
R7674:Rasgrf2	UTSW	13	92131406	missense	possibly damaging	0.65
R7784:Rasgrf2	UTSW	13	91896082	missense
R7962:Rasgrf2	UTSW	13	92030792	missense	probably damaging	0.99
R8056:Rasgrf2	UTSW	13	92030813	missense	probably damaging	0.97
R8218:Rasgrf2	UTSW	13	91982677	missense
R8796:Rasgrf2	UTSW	13	91890566	missense
R8913:Rasgrf2	UTSW	13	92022526	missense	probably benign	0.05
R8971:Rasgrf2	UTSW	13	92021717	missense	possibly damaging	0.80
R9020:Rasgrf2	UTSW	13	92028638	missense	possibly damaging	0.93
R9487:Rasgrf2	UTSW	13	92131251	missense	probably benign
R9562:Rasgrf2	UTSW	13	91886350	critical splice donor site	probably null
R9712:Rasgrf2	UTSW	13	91987973	missense
R9766:Rasgrf2	UTSW	13	92023680	missense	probably damaging	1.00
R9800:Rasgrf2	UTSW	13	92131352	missense	probably damaging	0.99
X0013:Rasgrf2	UTSW	13	92030855	missense	probably damaging	1.00
X0026:Rasgrf2	UTSW	13	91902535	missense	probably damaging	0.99
Z1177:Rasgrf2	UTSW	13	91983513	missense
Z1177:Rasgrf2	UTSW	13	92022573	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CTGATATCCACAAAGCGGGAGTACC -3'
(R):5'- CACCTGAACATCGCTCTGTCATCTG -3'

Sequencing Primer
(F):5'- AGCTTTGCCAGCACTACG -3'
(R):5'- TGTCATCTGTGGAAGACACC -3'

Posted On

2014-03-14