Mutagenetix > Incidental Mutations

Incidental Mutation 'R1443:Sntb1'

158677

Institutional Source

Beutler Lab

Gene Symbol

Sntb1

Ensembl Gene

ENSMUSG00000060429

Gene Name

syntrophin, basic 1

Synonyms

59-1 DAP, beta1-Syntrophin

MMRRC Submission

039498-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.113) question?

Stock #

R1443 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55636388-55906949 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 55647955 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 411 (L411H)

Ref Sequence

ENSEMBL: ENSMUSP00000041294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039769]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039769
AA Change: L411H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000041294
Gene: ENSMUSG00000060429
AA Change: L411H

Domain	Start	End	E-Value	Type
PH	19	299	5.14e0	SMART
PDZ	120	194	4.5e-17	SMART
PH	322	434	2.81e-8	SMART

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.2%
20x: 85.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in Duchenne Muscular Dystrophy patients and is present in reduced amounts in Becker Muscular Dystrophy patients. The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related proteins. This gene is a member of the syntrophin gene family, which contains at least two other structurally-related genes. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,262,798	S56R	probably damaging	Het
Actr8	A	G	14: 29,984,099	M99V	possibly damaging	Het
Adamtsl2	T	A	2: 27,103,066	C703S	possibly damaging	Het
Afap1	G	T	5: 35,968,661	K333N	probably damaging	Het
Aldh3a2	G	A	11: 61,264,307	S137L	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Aoc1	A	T	6: 48,905,445	K107M	possibly damaging	Het
Bmp8a	G	T	4: 123,316,965	S252R	possibly damaging	Het
C7	T	C	15: 5,059,419	I13M	probably benign	Het
Cblb	T	A	16: 52,139,611	D322E	possibly damaging	Het
Cfap54	G	A	10: 92,932,721	T180I	probably damaging	Het
Clrn2	C	T	5: 45,460,111	A108V	probably damaging	Het
Cspg4	T	A	9: 56,886,512	D510E	probably damaging	Het
Cyp2c40	A	T	19: 39,777,971	N393K	possibly damaging	Het
Dcaf5	T	C	12: 80,364,069	Y294C	probably damaging	Het
Dclk3	T	A	9: 111,469,020	M544K	probably benign	Het
Doxl2	A	T	6: 48,975,915	Y258F	probably damaging	Het
Ell3	A	T	2: 121,439,465	F388I	probably damaging	Het
Fam208b	T	C	13: 3,575,543	K1469R	probably benign	Het
Fam78b	A	G	1: 167,078,760	I163V	probably damaging	Het
Gnptab	T	C	10: 88,434,081	L882P	probably damaging	Het
Herc2	A	T	7: 56,204,733	D3802V	possibly damaging	Het
Hs3st5	A	G	10: 36,833,414	E315G	probably benign	Het
Idh3b	A	T	2: 130,284,054		probably null	Het
Lama4	G	A	10: 39,073,643	E911K	probably damaging	Het
Macf1	A	G	4: 123,511,007	I436T	probably damaging	Het
Mgam	C	A	6: 40,759,780	S871*	probably null	Het
Mtmr7	A	G	8: 40,560,882	S212P	probably damaging	Het
Mylk2	A	G	2: 152,919,416	T480A	probably damaging	Het
Myo3a	A	T	2: 22,282,626	N191I	probably damaging	Het
Nanog	C	T	6: 122,711,775	S105F	probably damaging	Het
Nanos2	A	G	7: 18,987,639	Y12C	probably damaging	Het
Nsg1	C	T	5: 38,155,643	V71I	probably benign	Het
Olfr1368	C	T	13: 21,142,167	V297I	probably benign	Het
Olfr1458	G	T	19: 13,103,204	Y33*	probably null	Het
Olfr1512	A	T	14: 52,372,951	I34N	probably damaging	Het
Olfr211	T	C	6: 116,494,425	L272S	probably benign	Het
Olfr643	A	T	7: 104,058,723	I293N	probably damaging	Het
Pcdhb17	A	G	18: 37,486,648	Q497R	probably benign	Het
Pcsk7	C	A	9: 45,925,986	P536Q	probably damaging	Het
Phactr4	G	A	4: 132,377,248	T256I	probably benign	Het
Phyhip	A	G	14: 70,467,291	K317E	probably damaging	Het
Pkhd1	C	T	1: 20,534,558	G1178R	probably damaging	Het
Ppp1r9a	G	A	6: 5,057,557	G544D	probably damaging	Het
Ptpn3	T	C	4: 57,225,775	D480G	probably benign	Het
Ptprn2	A	T	12: 117,253,615	K918N	probably damaging	Het
Rab42	T	C	4: 132,302,347	D188G	probably benign	Het
Rasgrf2	C	A	13: 91,983,676	D20Y	probably damaging	Het
Ryr2	G	A	13: 11,779,266	T942I	probably benign	Het
Sbpl	T	C	17: 23,953,354	K197R	unknown	Het
Slc44a1	T	A	4: 53,561,069	V595E	probably damaging	Het
Slc6a19	A	G	13: 73,684,344	M410T	probably damaging	Het
Synj2	A	G	17: 6,023,665	K245E	probably damaging	Het
Tmem131	G	A	1: 36,825,478	T558I	probably damaging	Het
Tnrc18	A	T	5: 142,771,533	S1078T	unknown	Het
Trmu	T	A	15: 85,897,101		probably null	Het
Ttn	A	T	2: 76,891,086		probably benign	Het
Tyw3	T	C	3: 154,587,523	T172A	probably benign	Het
Vldlr	T	C	19: 27,239,721	I348T	possibly damaging	Het
Zfp114	A	G	7: 24,177,769	D12G	probably damaging	Het

Other mutations in Sntb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02056:Sntb1	APN	15	55648039	missense	possibly damaging	0.93
IGL02732:Sntb1	APN	15	55792200	missense	possibly damaging	0.62
IGL02965:Sntb1	APN	15	55642685	nonsense	probably null
IGL03084:Sntb1	APN	15	55792091	missense	probably damaging	0.99
IGL03286:Sntb1	APN	15	55792046	missense	possibly damaging	0.59
R0117:Sntb1	UTSW	15	55906353	missense	probably benign
R0178:Sntb1	UTSW	15	55906144	missense	probably damaging	0.98
R0465:Sntb1	UTSW	15	55749276	missense	probably benign	0.02
R0626:Sntb1	UTSW	15	55642783	missense	probably benign	0.20
R0726:Sntb1	UTSW	15	55676356	missense	probably benign
R1125:Sntb1	UTSW	15	55749280	missense	probably benign
R1888:Sntb1	UTSW	15	55749349	nonsense	probably null
R1888:Sntb1	UTSW	15	55749349	nonsense	probably null
R2208:Sntb1	UTSW	15	55906318	missense	possibly damaging	0.79
R2426:Sntb1	UTSW	15	55906179	missense	probably damaging	1.00
R3721:Sntb1	UTSW	15	55642818	missense	probably benign	0.10
R4370:Sntb1	UTSW	15	55792091	missense	probably damaging	0.99
R4706:Sntb1	UTSW	15	55749274	missense	probably benign	0.09
R4883:Sntb1	UTSW	15	55642802	nonsense	probably null
R5223:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5242:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5270:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5313:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5314:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5316:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5336:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5337:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5396:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5398:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5427:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5428:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5429:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5431:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5594:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5658:Sntb1	UTSW	15	55792076	missense	probably damaging	1.00
R5665:Sntb1	UTSW	15	55792139	missense	probably benign	0.00
R6147:Sntb1	UTSW	15	55648010	missense	probably benign
R6159:Sntb1	UTSW	15	55676302	critical splice donor site	probably null
R6883:Sntb1	UTSW	15	55906323	missense	probably benign	0.38
R7008:Sntb1	UTSW	15	55792072	nonsense	probably null
R7168:Sntb1	UTSW	15	55791265	missense	probably benign	0.00
R7511:Sntb1	UTSW	15	55647951	missense	possibly damaging	0.71
R7600:Sntb1	UTSW	15	55792188	missense	possibly damaging	0.82
R8242:Sntb1	UTSW	15	55792233	missense	possibly damaging	0.95
R8804:Sntb1	UTSW	15	55792127	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- GGCCAGAGCAGTTATGGTTTCACC -3'
(R):5'- GCCCAGGCAGAAATATGCACATGC -3'

Sequencing Primer
(F):5'- AGCAGTTATGGTTTCACCTTCCC -3'
(R):5'- tttgtttgtttgcttgtttgtttg -3'

Posted On

2014-03-14