Incidental Mutation 'R1443:Trmu'
ID158678
Institutional Source Beutler Lab
Gene Symbol Trmu
Ensembl Gene ENSMUSG00000022386
Gene NametRNA 5-methylaminomethyl-2-thiouridylate methyltransferase
Synonyms1600025P05Rik, Trmt1, 1110005N20Rik
MMRRC Submission 039498-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R1443 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location85879312-85897394 bp(+) (GRCm38)
Type of Mutationsplice site (1829 bp from exon)
DNA Base Change (assembly) T to A at 85897101 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000016172] [ENSMUST00000023019] [ENSMUST00000162491]
Predicted Effect probably null
Transcript: ENSMUST00000016172
SMART Domains Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
low complexity region 221 240 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
CA 282 366 9.51e-26 SMART
CA 390 472 1.59e-27 SMART
CA 496 578 3.8e-25 SMART
CA 602 700 2.25e-27 SMART
CA 724 802 3.14e-17 SMART
CA 826 905 2.67e-29 SMART
CA 929 1012 3.23e-28 SMART
CA 1036 1114 4.17e-22 SMART
CA 1142 1218 6.89e-1 SMART
EGF 1321 1376 3.38e-3 SMART
EGF 1381 1414 5.49e-3 SMART
EGF 1421 1456 9.7e-4 SMART
LamG 1477 1644 2.53e-33 SMART
EGF 1667 1700 6.4e-4 SMART
LamG 1726 1864 1.13e-21 SMART
EGF 1890 1923 1.84e-4 SMART
EGF 1925 1961 5.49e-3 SMART
EGF_Lam 2018 2063 7.12e-11 SMART
HormR 2066 2128 2.55e-20 SMART
Pfam:GAIN 2140 2396 1.1e-64 PFAM
GPS 2422 2475 5.03e-22 SMART
Pfam:7tm_2 2480 2712 2.6e-60 PFAM
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2819 2852 N/A INTRINSIC
low complexity region 2976 2988 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000023019
AA Change: L393H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023019
Gene: ENSMUSG00000022386
AA Change: L393H

DomainStartEndE-ValueType
Pfam:NAD_synthase 1 133 7.7e-7 PFAM
Pfam:ThiI 3 79 7.7e-8 PFAM
Pfam:tRNA_Me_trans 5 383 3.4e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162010
Predicted Effect probably benign
Transcript: ENSMUST00000162339
SMART Domains Protein: ENSMUSP00000125266
Gene: ENSMUSG00000022386

DomainStartEndE-ValueType
Pfam:tRNA_Me_trans 1 46 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162491
SMART Domains Protein: ENSMUSP00000125704
Gene: ENSMUSG00000022386

DomainStartEndE-ValueType
Pfam:NAD_synthase 1 88 1.1e-8 PFAM
Pfam:Asn_synthase 1 90 3e-7 PFAM
Pfam:ThiI 3 84 1.6e-10 PFAM
Pfam:tRNA_Me_trans 5 88 2.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162601
Predicted Effect probably null
Transcript: ENSMUST00000226204
Predicted Effect probably null
Transcript: ENSMUST00000226840
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 85.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This nuclear gene encodes a mitochondrial tRNA-modifying enzyme. The encoded protein catalyzes the 2-thiolation of uridine on the wobble positions of tRNA(Lys), tRNA(Glu), and tRNA(Gln), resulting in the formation of 5-taurinomethyl-2-thiouridine moieties. Mutations in this gene may cause transient infantile liver failure. Polymorphisms in this gene may also influence the severity of deafness caused by mitochondrial 12S ribosomal RNA mutations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous KO is embryonic lethal. Homozygous conditional KO in the liver affects mitochondrial function owing to impaired mt-tRNA modifications. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,262,798 S56R probably damaging Het
Actr8 A G 14: 29,984,099 M99V possibly damaging Het
Adamtsl2 T A 2: 27,103,066 C703S possibly damaging Het
Afap1 G T 5: 35,968,661 K333N probably damaging Het
Aldh3a2 G A 11: 61,264,307 S137L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aoc1 A T 6: 48,905,445 K107M possibly damaging Het
Bmp8a G T 4: 123,316,965 S252R possibly damaging Het
C7 T C 15: 5,059,419 I13M probably benign Het
Cblb T A 16: 52,139,611 D322E possibly damaging Het
Cfap54 G A 10: 92,932,721 T180I probably damaging Het
Clrn2 C T 5: 45,460,111 A108V probably damaging Het
Cspg4 T A 9: 56,886,512 D510E probably damaging Het
Cyp2c40 A T 19: 39,777,971 N393K possibly damaging Het
Dcaf5 T C 12: 80,364,069 Y294C probably damaging Het
Dclk3 T A 9: 111,469,020 M544K probably benign Het
Doxl2 A T 6: 48,975,915 Y258F probably damaging Het
Ell3 A T 2: 121,439,465 F388I probably damaging Het
Fam208b T C 13: 3,575,543 K1469R probably benign Het
Fam78b A G 1: 167,078,760 I163V probably damaging Het
Gnptab T C 10: 88,434,081 L882P probably damaging Het
Herc2 A T 7: 56,204,733 D3802V possibly damaging Het
Hs3st5 A G 10: 36,833,414 E315G probably benign Het
Idh3b A T 2: 130,284,054 probably null Het
Lama4 G A 10: 39,073,643 E911K probably damaging Het
Macf1 A G 4: 123,511,007 I436T probably damaging Het
Mgam C A 6: 40,759,780 S871* probably null Het
Mtmr7 A G 8: 40,560,882 S212P probably damaging Het
Mylk2 A G 2: 152,919,416 T480A probably damaging Het
Myo3a A T 2: 22,282,626 N191I probably damaging Het
Nanog C T 6: 122,711,775 S105F probably damaging Het
Nanos2 A G 7: 18,987,639 Y12C probably damaging Het
Nsg1 C T 5: 38,155,643 V71I probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr1458 G T 19: 13,103,204 Y33* probably null Het
Olfr1512 A T 14: 52,372,951 I34N probably damaging Het
Olfr211 T C 6: 116,494,425 L272S probably benign Het
Olfr643 A T 7: 104,058,723 I293N probably damaging Het
Pcdhb17 A G 18: 37,486,648 Q497R probably benign Het
Pcsk7 C A 9: 45,925,986 P536Q probably damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Phyhip A G 14: 70,467,291 K317E probably damaging Het
Pkhd1 C T 1: 20,534,558 G1178R probably damaging Het
Ppp1r9a G A 6: 5,057,557 G544D probably damaging Het
Ptpn3 T C 4: 57,225,775 D480G probably benign Het
Ptprn2 A T 12: 117,253,615 K918N probably damaging Het
Rab42 T C 4: 132,302,347 D188G probably benign Het
Rasgrf2 C A 13: 91,983,676 D20Y probably damaging Het
Ryr2 G A 13: 11,779,266 T942I probably benign Het
Sbpl T C 17: 23,953,354 K197R unknown Het
Slc44a1 T A 4: 53,561,069 V595E probably damaging Het
Slc6a19 A G 13: 73,684,344 M410T probably damaging Het
Sntb1 A T 15: 55,647,955 L411H probably damaging Het
Synj2 A G 17: 6,023,665 K245E probably damaging Het
Tmem131 G A 1: 36,825,478 T558I probably damaging Het
Tnrc18 A T 5: 142,771,533 S1078T unknown Het
Ttn A T 2: 76,891,086 probably benign Het
Tyw3 T C 3: 154,587,523 T172A probably benign Het
Vldlr T C 19: 27,239,721 I348T possibly damaging Het
Zfp114 A G 7: 24,177,769 D12G probably damaging Het
Other mutations in Trmu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Trmu APN 15 85882831 missense probably benign 0.00
IGL02873:Trmu APN 15 85896832 splice site probably null
IGL03375:Trmu APN 15 85894937 missense possibly damaging 0.65
R0592:Trmu UTSW 15 85896826 unclassified probably benign
R0781:Trmu UTSW 15 85879403 nonsense probably null
R1120:Trmu UTSW 15 85890285 missense possibly damaging 0.75
R1165:Trmu UTSW 15 85892674 missense probably damaging 0.99
R1503:Trmu UTSW 15 85895019 missense possibly damaging 0.88
R4626:Trmu UTSW 15 85894985 missense possibly damaging 0.96
R4790:Trmu UTSW 15 85882805 missense probably damaging 1.00
R5134:Trmu UTSW 15 85896355 splice site probably null
R5399:Trmu UTSW 15 85896408 splice site probably null
R5639:Trmu UTSW 15 85882698 missense probably damaging 1.00
R6831:Trmu UTSW 15 85895006 missense probably benign
R8093:Trmu UTSW 15 85882720 missense probably benign 0.08
R8276:Trmu UTSW 15 85882731 missense possibly damaging 0.88
RF007:Trmu UTSW 15 85892569 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCTGACTCTCAATCAGGATGGCAC -3'
(R):5'- CCCCAGACACATGGTCAGACTTTG -3'

Sequencing Primer
(F):5'- CAATCAGGATGGCACTGTGTG -3'
(R):5'- TTTCCTGGAGCAGCAGC -3'
Posted On2014-03-14