Mutagenetix > Incidental Mutation

Incidental Mutation 'R1443:Cblb'

158680

Institutional Source

Beutler Lab

Gene Symbol

Cblb

Ensembl Gene

ENSMUSG00000022637

Gene Name

Casitas B-lineage lymphoma b

Synonyms

Cbl-b

MMRRC Submission

039498-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.222) question?

Stock #

R1443 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

52031225-52208048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 52139611 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 322 (D322E)

Ref Sequence

ENSEMBL: ENSMUSP00000153787 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114471] [ENSMUST00000226593] [ENSMUST00000227062] [ENSMUST00000227756] [ENSMUST00000227879]

AlphaFold

Q3TTA7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114471
AA Change: D322E

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000110115
Gene: ENSMUSG00000022637
AA Change: D322E

Domain	Start	End	E-Value	Type
low complexity region	6	21	N/A	INTRINSIC
Pfam:Cbl_N	41	167	1.5e-58	PFAM
Pfam:Cbl_N2	171	254	2.9e-43	PFAM
SH2	257	354	3.22e0	SMART
RING	373	411	1.04e-7	SMART
low complexity region	447	454	N/A	INTRINSIC
low complexity region	543	567	N/A	INTRINSIC
low complexity region	666	682	N/A	INTRINSIC
low complexity region	773	783	N/A	INTRINSIC
low complexity region	792	804	N/A	INTRINSIC
low complexity region	857	871	N/A	INTRINSIC
UBA	888	925	4.06e-6	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000226593
AA Change: D322E

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000227062
AA Change: D322E

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000227756
AA Change: D170E

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000227879
AA Change: D322E

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.2%
20x: 85.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for targeted null mutations exhibit elevated IL2 production by T cells, develop spontaneous autoimmunity, and are highly susceptible to experimental autoimmune encephalomyelitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,262,798	S56R	probably damaging	Het
Actr8	A	G	14: 29,984,099	M99V	possibly damaging	Het
Adamtsl2	T	A	2: 27,103,066	C703S	possibly damaging	Het
Afap1	G	T	5: 35,968,661	K333N	probably damaging	Het
Aldh3a2	G	A	11: 61,264,307	S137L	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Aoc1	A	T	6: 48,905,445	K107M	possibly damaging	Het
Bmp8a	G	T	4: 123,316,965	S252R	possibly damaging	Het
C7	T	C	15: 5,059,419	I13M	probably benign	Het
Cfap54	G	A	10: 92,932,721	T180I	probably damaging	Het
Clrn2	C	T	5: 45,460,111	A108V	probably damaging	Het
Cspg4	T	A	9: 56,886,512	D510E	probably damaging	Het
Cyp2c40	A	T	19: 39,777,971	N393K	possibly damaging	Het
Dcaf5	T	C	12: 80,364,069	Y294C	probably damaging	Het
Dclk3	T	A	9: 111,469,020	M544K	probably benign	Het
Doxl2	A	T	6: 48,975,915	Y258F	probably damaging	Het
Ell3	A	T	2: 121,439,465	F388I	probably damaging	Het
Fam208b	T	C	13: 3,575,543	K1469R	probably benign	Het
Fam78b	A	G	1: 167,078,760	I163V	probably damaging	Het
Gnptab	T	C	10: 88,434,081	L882P	probably damaging	Het
Herc2	A	T	7: 56,204,733	D3802V	possibly damaging	Het
Hs3st5	A	G	10: 36,833,414	E315G	probably benign	Het
Idh3b	A	T	2: 130,284,054		probably null	Het
Lama4	G	A	10: 39,073,643	E911K	probably damaging	Het
Macf1	A	G	4: 123,511,007	I436T	probably damaging	Het
Mgam	C	A	6: 40,759,780	S871*	probably null	Het
Mtmr7	A	G	8: 40,560,882	S212P	probably damaging	Het
Mylk2	A	G	2: 152,919,416	T480A	probably damaging	Het
Myo3a	A	T	2: 22,282,626	N191I	probably damaging	Het
Nanog	C	T	6: 122,711,775	S105F	probably damaging	Het
Nanos2	A	G	7: 18,987,639	Y12C	probably damaging	Het
Nsg1	C	T	5: 38,155,643	V71I	probably benign	Het
Olfr1368	C	T	13: 21,142,167	V297I	probably benign	Het
Olfr1458	G	T	19: 13,103,204	Y33*	probably null	Het
Olfr1512	A	T	14: 52,372,951	I34N	probably damaging	Het
Olfr211	T	C	6: 116,494,425	L272S	probably benign	Het
Olfr643	A	T	7: 104,058,723	I293N	probably damaging	Het
Pcdhb17	A	G	18: 37,486,648	Q497R	probably benign	Het
Pcsk7	C	A	9: 45,925,986	P536Q	probably damaging	Het
Phactr4	G	A	4: 132,377,248	T256I	probably benign	Het
Phyhip	A	G	14: 70,467,291	K317E	probably damaging	Het
Pkhd1	C	T	1: 20,534,558	G1178R	probably damaging	Het
Ppp1r9a	G	A	6: 5,057,557	G544D	probably damaging	Het
Ptpn3	T	C	4: 57,225,775	D480G	probably benign	Het
Ptprn2	A	T	12: 117,253,615	K918N	probably damaging	Het
Rab42	T	C	4: 132,302,347	D188G	probably benign	Het
Rasgrf2	C	A	13: 91,983,676	D20Y	probably damaging	Het
Ryr2	G	A	13: 11,779,266	T942I	probably benign	Het
Sbpl	T	C	17: 23,953,354	K197R	unknown	Het
Slc44a1	T	A	4: 53,561,069	V595E	probably damaging	Het
Slc6a19	A	G	13: 73,684,344	M410T	probably damaging	Het
Sntb1	A	T	15: 55,647,955	L411H	probably damaging	Het
Synj2	A	G	17: 6,023,665	K245E	probably damaging	Het
Tmem131	G	A	1: 36,825,478	T558I	probably damaging	Het
Tnrc18	A	T	5: 142,771,533	S1078T	unknown	Het
Trmu	T	A	15: 85,897,101		probably null	Het
Ttn	A	T	2: 76,891,086		probably benign	Het
Tyw3	T	C	3: 154,587,523	T172A	probably benign	Het
Vldlr	T	C	19: 27,239,721	I348T	possibly damaging	Het
Zfp114	A	G	7: 24,177,769	D12G	probably damaging	Het

Other mutations in Cblb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Cblb	APN	16	52183307	missense	probably benign	0.28
IGL00927:Cblb	APN	16	52166098	missense	probably benign
IGL01108:Cblb	APN	16	52047451	critical splice donor site	probably null
IGL01336:Cblb	APN	16	52186229	missense	probably benign	0.00
IGL01943:Cblb	APN	16	52139633	splice site	probably null
IGL02273:Cblb	APN	16	52047294	missense	possibly damaging	0.95
IGL02405:Cblb	APN	16	52166253	missense	probably benign	0.32
IGL02445:Cblb	APN	16	52166305	missense	probably damaging	1.00
IGL02728:Cblb	APN	16	52183309	missense	probably benign	0.04
IGL03000:Cblb	APN	16	52204542	missense	probably damaging	1.00
PIT4362001:Cblb	UTSW	16	52139542	nonsense	probably null
R0053:Cblb	UTSW	16	52142801	missense	probably damaging	0.97
R0053:Cblb	UTSW	16	52142801	missense	probably damaging	0.97
R0294:Cblb	UTSW	16	52135824	missense	probably damaging	1.00
R0403:Cblb	UTSW	16	52152626	missense	probably benign	0.23
R0506:Cblb	UTSW	16	52204480	missense	probably benign	0.25
R1172:Cblb	UTSW	16	52186240	splice site	probably benign
R1245:Cblb	UTSW	16	52047187	splice site	probably benign
R1549:Cblb	UTSW	16	52033010	splice site	probably benign
R1568:Cblb	UTSW	16	52135829	missense	probably damaging	1.00
R1734:Cblb	UTSW	16	52186240	splice site	probably benign
R2107:Cblb	UTSW	16	52152716	critical splice donor site	probably null
R2231:Cblb	UTSW	16	52194272	missense	probably benign	0.00
R4419:Cblb	UTSW	16	52047258	missense	possibly damaging	0.80
R4913:Cblb	UTSW	16	52166029	missense	possibly damaging	0.78
R4940:Cblb	UTSW	16	52033103	missense	probably damaging	1.00
R5159:Cblb	UTSW	16	52112120	missense	probably damaging	0.97
R5318:Cblb	UTSW	16	52186198	missense	possibly damaging	0.88
R5367:Cblb	UTSW	16	52204653	missense	probably damaging	1.00
R5432:Cblb	UTSW	16	52142865	missense	probably damaging	1.00
R5490:Cblb	UTSW	16	52174370	missense	possibly damaging	0.52
R5618:Cblb	UTSW	16	52152668	missense	possibly damaging	0.89
R6047:Cblb	UTSW	16	52112248	critical splice donor site	probably null
R6152:Cblb	UTSW	16	52141056	missense	probably damaging	0.98
R6667:Cblb	UTSW	16	52152644	missense	possibly damaging	0.81
R6914:Cblb	UTSW	16	52047430	missense	probably damaging	1.00
R7681:Cblb	UTSW	16	52204638	missense	probably damaging	0.96
R7940:Cblb	UTSW	16	52152536	missense	probably damaging	1.00
R8167:Cblb	UTSW	16	52166002	missense	probably benign	0.13
R8236:Cblb	UTSW	16	52166029	missense	possibly damaging	0.85
R8494:Cblb	UTSW	16	52204640	missense	probably damaging	1.00
R8880:Cblb	UTSW	16	52166005	missense	probably benign
R9308:Cblb	UTSW	16	52189011	critical splice acceptor site	probably null
R9386:Cblb	UTSW	16	52166338	nonsense	probably null
R9387:Cblb	UTSW	16	52033152	missense	probably benign	0.12
R9500:Cblb	UTSW	16	52139630	critical splice donor site	probably null
R9741:Cblb	UTSW	16	52112127	missense	probably damaging	1.00
X0011:Cblb	UTSW	16	52152629	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- ATGTCACAGCTCTATCACAGCAGC -3'
(R):5'- AGGCACCACTATTGCTATTGGTTCG -3'

Sequencing Primer
(F):5'- CTAAATGATGCTGCTCAAGAAGAC -3'
(R):5'- GCTCTATGCCCAGACAGTTT -3'

Posted On

2014-03-14