Incidental Mutation 'R1443:Sbpl'
ID158683
Institutional Source Beutler Lab
Gene Symbol Sbpl
Ensembl Gene ENSMUSG00000024125
Gene Namespermine binding protein-like
Synonyms
MMRRC Submission 039498-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1443 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location23953085-23954919 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23953354 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 197 (K197R)
Ref Sequence ENSEMBL: ENSMUSP00000024939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024939]
Predicted Effect unknown
Transcript: ENSMUST00000024939
AA Change: K197R
SMART Domains Protein: ENSMUSP00000024939
Gene: ENSMUSG00000024125
AA Change: K197R

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Jacalin 41 166 6.56e-15 SMART
low complexity region 178 231 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 85.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,262,798 S56R probably damaging Het
Actr8 A G 14: 29,984,099 M99V possibly damaging Het
Adamtsl2 T A 2: 27,103,066 C703S possibly damaging Het
Afap1 G T 5: 35,968,661 K333N probably damaging Het
Aldh3a2 G A 11: 61,264,307 S137L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aoc1 A T 6: 48,905,445 K107M possibly damaging Het
Bmp8a G T 4: 123,316,965 S252R possibly damaging Het
C7 T C 15: 5,059,419 I13M probably benign Het
Cblb T A 16: 52,139,611 D322E possibly damaging Het
Cfap54 G A 10: 92,932,721 T180I probably damaging Het
Clrn2 C T 5: 45,460,111 A108V probably damaging Het
Cspg4 T A 9: 56,886,512 D510E probably damaging Het
Cyp2c40 A T 19: 39,777,971 N393K possibly damaging Het
Dcaf5 T C 12: 80,364,069 Y294C probably damaging Het
Dclk3 T A 9: 111,469,020 M544K probably benign Het
Doxl2 A T 6: 48,975,915 Y258F probably damaging Het
Ell3 A T 2: 121,439,465 F388I probably damaging Het
Fam208b T C 13: 3,575,543 K1469R probably benign Het
Fam78b A G 1: 167,078,760 I163V probably damaging Het
Gnptab T C 10: 88,434,081 L882P probably damaging Het
Herc2 A T 7: 56,204,733 D3802V possibly damaging Het
Hs3st5 A G 10: 36,833,414 E315G probably benign Het
Idh3b A T 2: 130,284,054 probably null Het
Lama4 G A 10: 39,073,643 E911K probably damaging Het
Macf1 A G 4: 123,511,007 I436T probably damaging Het
Mgam C A 6: 40,759,780 S871* probably null Het
Mtmr7 A G 8: 40,560,882 S212P probably damaging Het
Mylk2 A G 2: 152,919,416 T480A probably damaging Het
Myo3a A T 2: 22,282,626 N191I probably damaging Het
Nanog C T 6: 122,711,775 S105F probably damaging Het
Nanos2 A G 7: 18,987,639 Y12C probably damaging Het
Nsg1 C T 5: 38,155,643 V71I probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr1458 G T 19: 13,103,204 Y33* probably null Het
Olfr1512 A T 14: 52,372,951 I34N probably damaging Het
Olfr211 T C 6: 116,494,425 L272S probably benign Het
Olfr643 A T 7: 104,058,723 I293N probably damaging Het
Pcdhb17 A G 18: 37,486,648 Q497R probably benign Het
Pcsk7 C A 9: 45,925,986 P536Q probably damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Phyhip A G 14: 70,467,291 K317E probably damaging Het
Pkhd1 C T 1: 20,534,558 G1178R probably damaging Het
Ppp1r9a G A 6: 5,057,557 G544D probably damaging Het
Ptpn3 T C 4: 57,225,775 D480G probably benign Het
Ptprn2 A T 12: 117,253,615 K918N probably damaging Het
Rab42 T C 4: 132,302,347 D188G probably benign Het
Rasgrf2 C A 13: 91,983,676 D20Y probably damaging Het
Ryr2 G A 13: 11,779,266 T942I probably benign Het
Slc44a1 T A 4: 53,561,069 V595E probably damaging Het
Slc6a19 A G 13: 73,684,344 M410T probably damaging Het
Sntb1 A T 15: 55,647,955 L411H probably damaging Het
Synj2 A G 17: 6,023,665 K245E probably damaging Het
Tmem131 G A 1: 36,825,478 T558I probably damaging Het
Tnrc18 A T 5: 142,771,533 S1078T unknown Het
Trmu T A 15: 85,897,101 probably null Het
Ttn A T 2: 76,891,086 probably benign Het
Tyw3 T C 3: 154,587,523 T172A probably benign Het
Vldlr T C 19: 27,239,721 I348T possibly damaging Het
Zfp114 A G 7: 24,177,769 D12G probably damaging Het
Other mutations in Sbpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:Sbpl APN 17 23953716 missense probably benign 0.01
IGL02525:Sbpl APN 17 23954863 missense unknown
R1466:Sbpl UTSW 17 23953254 missense unknown
R1466:Sbpl UTSW 17 23953254 missense unknown
R1751:Sbpl UTSW 17 23954803 splice site probably null
R1893:Sbpl UTSW 17 23953267 missense unknown
R3939:Sbpl UTSW 17 23953643 missense probably benign 0.12
R4399:Sbpl UTSW 17 23954886 missense unknown
R4421:Sbpl UTSW 17 23954886 missense unknown
R4783:Sbpl UTSW 17 23953330 missense unknown
R5526:Sbpl UTSW 17 23954649 missense probably damaging 0.98
R6181:Sbpl UTSW 17 23953492 missense probably damaging 0.96
R7055:Sbpl UTSW 17 23953302 missense unknown
R7102:Sbpl UTSW 17 23954634 nonsense probably null
R7162:Sbpl UTSW 17 23953465 missense possibly damaging 0.73
R7818:Sbpl UTSW 17 23953262 missense unknown
R8084:Sbpl UTSW 17 23953270 missense unknown
Z1088:Sbpl UTSW 17 23953544 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTTCCTCCAGTGGGAGAGCTTG -3'
(R):5'- AGTGATCTGCCTGACTTCCCTGAC -3'

Sequencing Primer
(F):5'- TTGGCTGAGAGGAGGCG -3'
(R):5'- GGTCGCTACTTCAGTGACAC -3'
Posted On2014-03-14