Mutagenetix > Incidental Mutation

Incidental Mutation 'R1443:Pcdhb17'

158684

Institutional Source

Beutler Lab

Gene Symbol

Pcdhb17

Ensembl Gene

ENSMUSG00000046387

Gene Name

protocadherin beta 17

Synonyms

PcdhbQ, Pcdhb16

MMRRC Submission

039498-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R1443 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37484795-37489454 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 37486648 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 497 (Q497R)

Ref Sequence

ENSEMBL: ENSMUSP00000055072 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051442] [ENSMUST00000053856] [ENSMUST00000055949] [ENSMUST00000115661] [ENSMUST00000194544]

AlphaFold

Q91VD8

Predicted Effect

probably benign
Transcript: ENSMUST00000051442

SMART Domains

Protein: ENSMUSP00000056347
Gene: ENSMUSG00000047910

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	46	132	7.7e-1	SMART
CA	156	241	1.93e-17	SMART
CA	265	346	4.2e-27	SMART
CA	369	450	1.08e-24	SMART
CA	474	560	3.31e-25	SMART
CA	590	671	2.87e-11	SMART
Pfam:Cadherin_C_2	687	770	4.1e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000053856
AA Change: Q497R

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000055072
Gene: ENSMUSG00000046387
AA Change: Q497R

Domain	Start	End	E-Value	Type
Pfam:Cadherin_2	31	112	5.8e-35	PFAM
CA	155	240	2.42e-18	SMART
CA	264	345	8.03e-24	SMART
CA	368	449	5.81e-21	SMART
CA	473	559	8.15e-25	SMART
CA	589	670	6.34e-13	SMART
Pfam:Cadherin_C_2	686	770	1.8e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000055949

SMART Domains

Protein: ENSMUSP00000052113
Gene: ENSMUSG00000048347

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Cadherin_2	30	112	3.1e-34	PFAM
CA	155	240	7.97e-19	SMART
CA	264	345	6.27e-26	SMART
CA	368	449	2.63e-19	SMART
CA	473	559	7.09e-25	SMART
CA	589	670	2.87e-11	SMART
Pfam:Cadherin_C_2	687	771	7.9e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115661

SMART Domains

Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

Domain	Start	End	E-Value	Type
CA	20	131	5.3e-2	SMART
CA	155	240	1.51e-19	SMART
CA	264	348	7.6e-25	SMART
CA	372	453	1.42e-24	SMART
CA	477	563	1.42e-24	SMART
CA	594	674	4.12e-12	SMART
low complexity region	706	721	N/A	INTRINSIC
Pfam:Cadherin_tail	796	930	3.9e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000193984

Predicted Effect

probably benign
Transcript: ENSMUST00000194544

SMART Domains

Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

Domain	Start	End	E-Value	Type
Blast:CA	18	66	5e-20	BLAST

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.2%
20x: 85.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,262,798	S56R	probably damaging	Het
Actr8	A	G	14: 29,984,099	M99V	possibly damaging	Het
Adamtsl2	T	A	2: 27,103,066	C703S	possibly damaging	Het
Afap1	G	T	5: 35,968,661	K333N	probably damaging	Het
Aldh3a2	G	A	11: 61,264,307	S137L	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Aoc1	A	T	6: 48,905,445	K107M	possibly damaging	Het
Bmp8a	G	T	4: 123,316,965	S252R	possibly damaging	Het
C7	T	C	15: 5,059,419	I13M	probably benign	Het
Cblb	T	A	16: 52,139,611	D322E	possibly damaging	Het
Cfap54	G	A	10: 92,932,721	T180I	probably damaging	Het
Clrn2	C	T	5: 45,460,111	A108V	probably damaging	Het
Cspg4	T	A	9: 56,886,512	D510E	probably damaging	Het
Cyp2c40	A	T	19: 39,777,971	N393K	possibly damaging	Het
Dcaf5	T	C	12: 80,364,069	Y294C	probably damaging	Het
Dclk3	T	A	9: 111,469,020	M544K	probably benign	Het
Doxl2	A	T	6: 48,975,915	Y258F	probably damaging	Het
Ell3	A	T	2: 121,439,465	F388I	probably damaging	Het
Fam208b	T	C	13: 3,575,543	K1469R	probably benign	Het
Fam78b	A	G	1: 167,078,760	I163V	probably damaging	Het
Gnptab	T	C	10: 88,434,081	L882P	probably damaging	Het
Herc2	A	T	7: 56,204,733	D3802V	possibly damaging	Het
Hs3st5	A	G	10: 36,833,414	E315G	probably benign	Het
Idh3b	A	T	2: 130,284,054		probably null	Het
Lama4	G	A	10: 39,073,643	E911K	probably damaging	Het
Macf1	A	G	4: 123,511,007	I436T	probably damaging	Het
Mgam	C	A	6: 40,759,780	S871*	probably null	Het
Mtmr7	A	G	8: 40,560,882	S212P	probably damaging	Het
Mylk2	A	G	2: 152,919,416	T480A	probably damaging	Het
Myo3a	A	T	2: 22,282,626	N191I	probably damaging	Het
Nanog	C	T	6: 122,711,775	S105F	probably damaging	Het
Nanos2	A	G	7: 18,987,639	Y12C	probably damaging	Het
Nsg1	C	T	5: 38,155,643	V71I	probably benign	Het
Olfr1368	C	T	13: 21,142,167	V297I	probably benign	Het
Olfr1458	G	T	19: 13,103,204	Y33*	probably null	Het
Olfr1512	A	T	14: 52,372,951	I34N	probably damaging	Het
Olfr211	T	C	6: 116,494,425	L272S	probably benign	Het
Olfr643	A	T	7: 104,058,723	I293N	probably damaging	Het
Pcsk7	C	A	9: 45,925,986	P536Q	probably damaging	Het
Phactr4	G	A	4: 132,377,248	T256I	probably benign	Het
Phyhip	A	G	14: 70,467,291	K317E	probably damaging	Het
Pkhd1	C	T	1: 20,534,558	G1178R	probably damaging	Het
Ppp1r9a	G	A	6: 5,057,557	G544D	probably damaging	Het
Ptpn3	T	C	4: 57,225,775	D480G	probably benign	Het
Ptprn2	A	T	12: 117,253,615	K918N	probably damaging	Het
Rab42	T	C	4: 132,302,347	D188G	probably benign	Het
Rasgrf2	C	A	13: 91,983,676	D20Y	probably damaging	Het
Ryr2	G	A	13: 11,779,266	T942I	probably benign	Het
Sbpl	T	C	17: 23,953,354	K197R	unknown	Het
Slc44a1	T	A	4: 53,561,069	V595E	probably damaging	Het
Slc6a19	A	G	13: 73,684,344	M410T	probably damaging	Het
Sntb1	A	T	15: 55,647,955	L411H	probably damaging	Het
Synj2	A	G	17: 6,023,665	K245E	probably damaging	Het
Tmem131	G	A	1: 36,825,478	T558I	probably damaging	Het
Tnrc18	A	T	5: 142,771,533	S1078T	unknown	Het
Trmu	T	A	15: 85,897,101		probably null	Het
Ttn	A	T	2: 76,891,086		probably benign	Het
Tyw3	T	C	3: 154,587,523	T172A	probably benign	Het
Vldlr	T	C	19: 27,239,721	I348T	possibly damaging	Het
Zfp114	A	G	7: 24,177,769	D12G	probably damaging	Het

Other mutations in Pcdhb17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Pcdhb17	APN	18	37486006	splice site	probably null
IGL01367:Pcdhb17	APN	18	37487495	missense	probably benign	0.01
IGL01923:Pcdhb17	APN	18	37486737	missense	probably benign	0.43
IGL02060:Pcdhb17	APN	18	37486416	missense	probably damaging	1.00
IGL02494:Pcdhb17	APN	18	37485294	missense	possibly damaging	0.73
IGL02654:Pcdhb17	APN	18	37486561	missense	probably benign	0.03
IGL03168:Pcdhb17	APN	18	37485772	missense	probably benign	0.15
doughnut	UTSW	18	37486936	missense	probably damaging	1.00
miniscule	UTSW	18	37485667	missense	probably damaging	1.00
PIT4434001:Pcdhb17	UTSW	18	37485651	missense	probably damaging	1.00
R0364:Pcdhb17	UTSW	18	37485835	missense	possibly damaging	0.95
R1013:Pcdhb17	UTSW	18	37485967	missense	probably damaging	1.00
R1052:Pcdhb17	UTSW	18	37486846	missense	probably damaging	1.00
R1226:Pcdhb17	UTSW	18	37487260	missense	probably damaging	1.00
R1258:Pcdhb17	UTSW	18	37485534	missense	probably damaging	0.98
R1335:Pcdhb17	UTSW	18	37486234	missense	probably damaging	1.00
R1451:Pcdhb17	UTSW	18	37486936	missense	probably damaging	1.00
R1505:Pcdhb17	UTSW	18	37486822	missense	probably damaging	1.00
R1591:Pcdhb17	UTSW	18	37485825	missense	probably damaging	1.00
R1742:Pcdhb17	UTSW	18	37486576	missense	probably damaging	0.99
R1750:Pcdhb17	UTSW	18	37485711	missense	probably damaging	1.00
R1750:Pcdhb17	UTSW	18	37487017	missense	possibly damaging	0.81
R1764:Pcdhb17	UTSW	18	37487271	missense	probably damaging	1.00
R1863:Pcdhb17	UTSW	18	37486111	missense	probably benign	0.00
R1888:Pcdhb17	UTSW	18	37487385	splice site	probably null
R1888:Pcdhb17	UTSW	18	37487385	splice site	probably null
R2095:Pcdhb17	UTSW	18	37486322	missense	probably benign	0.14
R4565:Pcdhb17	UTSW	18	37486470	missense	probably benign	0.14
R4658:Pcdhb17	UTSW	18	37486599	missense	probably damaging	1.00
R4669:Pcdhb17	UTSW	18	37486206	missense	probably damaging	0.99
R4816:Pcdhb17	UTSW	18	37487397	missense	probably benign	0.39
R4910:Pcdhb17	UTSW	18	37485159	start codon destroyed	possibly damaging	0.90
R5209:Pcdhb17	UTSW	18	37487461	missense	probably damaging	1.00
R5248:Pcdhb17	UTSW	18	37485886	missense	probably benign	0.00
R5254:Pcdhb17	UTSW	18	37486825	missense	probably damaging	1.00
R5494:Pcdhb17	UTSW	18	37487247	missense	probably damaging	1.00
R5544:Pcdhb17	UTSW	18	37487421	missense	possibly damaging	0.61
R5952:Pcdhb17	UTSW	18	37487080	missense	probably benign	0.04
R5977:Pcdhb17	UTSW	18	37485667	missense	probably damaging	1.00
R6262:Pcdhb17	UTSW	18	37486698	missense	probably damaging	1.00
R6311:Pcdhb17	UTSW	18	37486263	splice site	probably null
R6495:Pcdhb17	UTSW	18	37485667	missense	probably damaging	1.00
R6710:Pcdhb17	UTSW	18	37485399	missense	probably damaging	0.96
R7097:Pcdhb17	UTSW	18	37486513	missense	probably benign
R7122:Pcdhb17	UTSW	18	37486513	missense	probably benign
R7130:Pcdhb17	UTSW	18	37485445	missense	probably damaging	1.00
R7437:Pcdhb17	UTSW	18	37486092	missense	probably benign	0.01
R7642:Pcdhb17	UTSW	18	37485726	missense	probably damaging	1.00
R7703:Pcdhb17	UTSW	18	37486748	missense	probably benign	0.01
R7771:Pcdhb17	UTSW	18	37486909	missense	possibly damaging	0.95
R7898:Pcdhb17	UTSW	18	37485180	missense	probably benign	0.00
R8028:Pcdhb17	UTSW	18	37487449	missense	probably benign	0.03
R8299:Pcdhb17	UTSW	18	37485355	missense	probably damaging	0.98
R8560:Pcdhb17	UTSW	18	37486153	missense	possibly damaging	0.92
R8844:Pcdhb17	UTSW	18	37485748	missense	probably benign	0.12
R8925:Pcdhb17	UTSW	18	37487319	missense	probably benign	0.40
R8927:Pcdhb17	UTSW	18	37487319	missense	probably benign	0.40
R9050:Pcdhb17	UTSW	18	37487233	missense	probably damaging	1.00
R9162:Pcdhb17	UTSW	18	37487115	missense	probably damaging	0.97
R9243:Pcdhb17	UTSW	18	37486936	missense	probably damaging	1.00
R9286:Pcdhb17	UTSW	18	37486369	missense	probably benign	0.26
R9472:Pcdhb17	UTSW	18	37485866	missense	probably damaging	1.00
R9617:Pcdhb17	UTSW	18	37485165	missense	probably benign
R9625:Pcdhb17	UTSW	18	37486366	nonsense	probably null
R9646:Pcdhb17	UTSW	18	37485418	missense	possibly damaging	0.64
X0062:Pcdhb17	UTSW	18	37486489	missense	probably benign
X0064:Pcdhb17	UTSW	18	37486431	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGATGCTATCTGCTCTTACCAGCC -3'
(R):5'- TGTCATTGTCGTCCAGCACCAC -3'

Sequencing Primer
(F):5'- TGATTGCCTCCATCGAAGAAG -3'
(R):5'- TTGGTCTATTGCACCCACGT -3'

Posted On

2014-03-14