Incidental Mutation 'R1443:Vldlr'
ID158687
Institutional Source Beutler Lab
Gene Symbol Vldlr
Ensembl Gene ENSMUSG00000024924
Gene Namevery low density lipoprotein receptor
SynonymsAA408956, AI451093, AW047288, VLDL receptor
MMRRC Submission 039498-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.366) question?
Stock #R1443 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location27216484-27254231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27239721 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 348 (I348T)
Ref Sequence ENSEMBL: ENSMUSP00000049145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025866] [ENSMUST00000047645] [ENSMUST00000164746] [ENSMUST00000165761] [ENSMUST00000167487] [ENSMUST00000172302]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025866
AA Change: I389T

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025866
Gene: ENSMUSG00000024924
AA Change: I389T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
Blast:LY 461 495 4e-15 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000047645
AA Change: I348T

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049145
Gene: ENSMUSG00000024924
AA Change: I348T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 1.25e-14 SMART
LDLa 112 149 7.15e-15 SMART
LDLa 151 190 1.23e-13 SMART
LDLa 197 234 1.1e-15 SMART
LDLa 236 273 1.13e-12 SMART
LDLa 276 316 3.86e-11 SMART
EGF_CA 315 354 1e-5 SMART
EGF_CA 355 394 6.1e-10 SMART
LY 420 462 2.16e-1 SMART
LY 464 506 9.54e-12 SMART
LY 507 550 2.22e-12 SMART
LY 551 593 1.66e-11 SMART
LY 594 637 5.97e-4 SMART
EGF 664 709 2.16e-1 SMART
transmembrane domain 728 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164509
Predicted Effect probably benign
Transcript: ENSMUST00000164746
SMART Domains Protein: ENSMUSP00000128193
Gene: ENSMUSG00000024924

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LDLa 32 69 1.69e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165761
AA Change: I58T

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130382
Gene: ENSMUSG00000024924
AA Change: I58T

DomainStartEndE-ValueType
LDLa 1 26 1.58e0 SMART
EGF 28 64 4e-5 SMART
LY 88 130 2.16e-1 SMART
LY 132 174 9.54e-12 SMART
LY 175 218 2.22e-12 SMART
LY 219 258 3.25e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167487
AA Change: I389T

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127329
Gene: ENSMUSG00000024924
AA Change: I389T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
LY 461 503 2.16e-1 SMART
LY 505 547 9.54e-12 SMART
LY 548 591 2.22e-12 SMART
LY 592 634 1.66e-11 SMART
LY 635 678 5.97e-4 SMART
EGF 705 750 2.16e-1 SMART
transmembrane domain 797 819 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172302
AA Change: I389T

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126730
Gene: ENSMUSG00000024924
AA Change: I389T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
LY 461 503 2.16e-1 SMART
LY 505 547 9.54e-12 SMART
LY 548 591 2.22e-12 SMART
LY 592 634 1.66e-11 SMART
LY 635 678 5.97e-4 SMART
EGF 705 750 2.16e-1 SMART
transmembrane domain 769 791 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 85.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. This gene encodes a lipoprotein receptor that is a member of the LDLR family and plays important roles in VLDL-triglyceride metabolism and the reelin signaling pathway. Mutations in this gene cause VLDLR-associated cerebellar hypoplasia. Alternative splicing generates multiple transcript variants encoding distinct isoforms for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygous null mutants exhibit modest reductions in body weight and adiposity. In behavioral tests, mutants display deficits in contextual fear conditioning and long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,262,798 S56R probably damaging Het
Actr8 A G 14: 29,984,099 M99V possibly damaging Het
Adamtsl2 T A 2: 27,103,066 C703S possibly damaging Het
Afap1 G T 5: 35,968,661 K333N probably damaging Het
Aldh3a2 G A 11: 61,264,307 S137L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aoc1 A T 6: 48,905,445 K107M possibly damaging Het
Bmp8a G T 4: 123,316,965 S252R possibly damaging Het
C7 T C 15: 5,059,419 I13M probably benign Het
Cblb T A 16: 52,139,611 D322E possibly damaging Het
Cfap54 G A 10: 92,932,721 T180I probably damaging Het
Clrn2 C T 5: 45,460,111 A108V probably damaging Het
Cspg4 T A 9: 56,886,512 D510E probably damaging Het
Cyp2c40 A T 19: 39,777,971 N393K possibly damaging Het
Dcaf5 T C 12: 80,364,069 Y294C probably damaging Het
Dclk3 T A 9: 111,469,020 M544K probably benign Het
Doxl2 A T 6: 48,975,915 Y258F probably damaging Het
Ell3 A T 2: 121,439,465 F388I probably damaging Het
Fam208b T C 13: 3,575,543 K1469R probably benign Het
Fam78b A G 1: 167,078,760 I163V probably damaging Het
Gnptab T C 10: 88,434,081 L882P probably damaging Het
Herc2 A T 7: 56,204,733 D3802V possibly damaging Het
Hs3st5 A G 10: 36,833,414 E315G probably benign Het
Idh3b A T 2: 130,284,054 probably null Het
Lama4 G A 10: 39,073,643 E911K probably damaging Het
Macf1 A G 4: 123,511,007 I436T probably damaging Het
Mgam C A 6: 40,759,780 S871* probably null Het
Mtmr7 A G 8: 40,560,882 S212P probably damaging Het
Mylk2 A G 2: 152,919,416 T480A probably damaging Het
Myo3a A T 2: 22,282,626 N191I probably damaging Het
Nanog C T 6: 122,711,775 S105F probably damaging Het
Nanos2 A G 7: 18,987,639 Y12C probably damaging Het
Nsg1 C T 5: 38,155,643 V71I probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr1458 G T 19: 13,103,204 Y33* probably null Het
Olfr1512 A T 14: 52,372,951 I34N probably damaging Het
Olfr211 T C 6: 116,494,425 L272S probably benign Het
Olfr643 A T 7: 104,058,723 I293N probably damaging Het
Pcdhb17 A G 18: 37,486,648 Q497R probably benign Het
Pcsk7 C A 9: 45,925,986 P536Q probably damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Phyhip A G 14: 70,467,291 K317E probably damaging Het
Pkhd1 C T 1: 20,534,558 G1178R probably damaging Het
Ppp1r9a G A 6: 5,057,557 G544D probably damaging Het
Ptpn3 T C 4: 57,225,775 D480G probably benign Het
Ptprn2 A T 12: 117,253,615 K918N probably damaging Het
Rab42 T C 4: 132,302,347 D188G probably benign Het
Rasgrf2 C A 13: 91,983,676 D20Y probably damaging Het
Ryr2 G A 13: 11,779,266 T942I probably benign Het
Sbpl T C 17: 23,953,354 K197R unknown Het
Slc44a1 T A 4: 53,561,069 V595E probably damaging Het
Slc6a19 A G 13: 73,684,344 M410T probably damaging Het
Sntb1 A T 15: 55,647,955 L411H probably damaging Het
Synj2 A G 17: 6,023,665 K245E probably damaging Het
Tmem131 G A 1: 36,825,478 T558I probably damaging Het
Tnrc18 A T 5: 142,771,533 S1078T unknown Het
Trmu T A 15: 85,897,101 probably null Het
Ttn A T 2: 76,891,086 probably benign Het
Tyw3 T C 3: 154,587,523 T172A probably benign Het
Zfp114 A G 7: 24,177,769 D12G probably damaging Het
Other mutations in Vldlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Vldlr APN 19 27239681 missense possibly damaging 0.93
IGL01575:Vldlr APN 19 27246631 missense probably benign
IGL01626:Vldlr APN 19 27243773 missense probably damaging 1.00
IGL02213:Vldlr APN 19 27241326 missense probably benign 0.09
IGL02365:Vldlr APN 19 27245625 missense probably damaging 1.00
IGL02488:Vldlr APN 19 27238275 missense probably damaging 1.00
IGL02708:Vldlr APN 19 27238085 missense possibly damaging 0.92
IGL02947:Vldlr APN 19 27239720 missense probably benign 0.03
disturbed UTSW 19 27238804 nonsense probably null
r26 UTSW 19 27245654 missense probably damaging 0.99
spotty UTSW 19 27238792 missense probably damaging 1.00
PIT4142001:Vldlr UTSW 19 27234869 missense probably benign 0.05
R0195:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R0288:Vldlr UTSW 19 27240651 splice site probably benign
R0536:Vldlr UTSW 19 27239964 missense probably damaging 1.00
R0537:Vldlr UTSW 19 27247918 missense probably damaging 1.00
R0542:Vldlr UTSW 19 27236255 missense probably benign 0.01
R0594:Vldlr UTSW 19 27234819 missense probably damaging 1.00
R0624:Vldlr UTSW 19 27238263 missense possibly damaging 0.91
R0726:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R1017:Vldlr UTSW 19 27241333 missense probably damaging 1.00
R1148:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1148:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1493:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1520:Vldlr UTSW 19 27240543 missense probably damaging 0.99
R1520:Vldlr UTSW 19 27247066 missense possibly damaging 0.96
R1657:Vldlr UTSW 19 27245670 missense probably benign 0.00
R1901:Vldlr UTSW 19 27241309 missense probably damaging 1.00
R2047:Vldlr UTSW 19 27234838 missense probably damaging 1.00
R2258:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R2273:Vldlr UTSW 19 27248015 missense probably damaging 1.00
R2423:Vldlr UTSW 19 27236288 missense possibly damaging 0.49
R3196:Vldlr UTSW 19 27243154 missense probably damaging 0.98
R3752:Vldlr UTSW 19 27238331 missense probably damaging 1.00
R3801:Vldlr UTSW 19 27217621 missense probably damaging 0.99
R3835:Vldlr UTSW 19 27234814 missense probably damaging 1.00
R4027:Vldlr UTSW 19 27238313 missense probably benign
R4301:Vldlr UTSW 19 27238402 missense possibly damaging 0.80
R4470:Vldlr UTSW 19 27234819 missense probably damaging 0.96
R4541:Vldlr UTSW 19 27238792 missense probably damaging 1.00
R4765:Vldlr UTSW 19 27240547 missense probably damaging 1.00
R4771:Vldlr UTSW 19 27239890 missense probably damaging 0.97
R4795:Vldlr UTSW 19 27238852 splice site probably null
R4839:Vldlr UTSW 19 27238065 missense probably damaging 1.00
R5074:Vldlr UTSW 19 27238277 missense probably damaging 1.00
R5134:Vldlr UTSW 19 27238812 nonsense probably null
R5281:Vldlr UTSW 19 27244231 missense probably benign 0.44
R5466:Vldlr UTSW 19 27239843 critical splice acceptor site probably null
R5514:Vldlr UTSW 19 27244224 missense probably damaging 0.97
R5886:Vldlr UTSW 19 27243771 missense probably benign 0.03
R5889:Vldlr UTSW 19 27239664 missense probably damaging 1.00
R6110:Vldlr UTSW 19 27238077 missense possibly damaging 0.92
R6343:Vldlr UTSW 19 27245649 missense probably damaging 0.99
R6833:Vldlr UTSW 19 27240574 missense probably damaging 1.00
R6838:Vldlr UTSW 19 27247970 missense probably damaging 1.00
R7169:Vldlr UTSW 19 27244328 missense probably benign
R7197:Vldlr UTSW 19 27234841 missense probably benign 0.36
R7304:Vldlr UTSW 19 27238604 missense possibly damaging 0.93
R7403:Vldlr UTSW 19 27236274 nonsense probably null
R7658:Vldlr UTSW 19 27243136 missense probably benign 0.33
R7754:Vldlr UTSW 19 27217615 start codon destroyed probably benign 0.01
R8105:Vldlr UTSW 19 27238804 nonsense probably null
R8377:Vldlr UTSW 19 27234858 missense probably damaging 1.00
R8529:Vldlr UTSW 19 27230256 missense probably benign 0.03
R8777:Vldlr UTSW 19 27240546 missense probably benign 0.00
R8777-TAIL:Vldlr UTSW 19 27240546 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCAATAGCCGGAGACTGAATGTGA -3'
(R):5'- GCAAGATCCATTTGATAGCCACGACT -3'

Sequencing Primer
(F):5'- tgggaggcagaggcagg -3'
(R):5'- TTTGATAGCCACGACTACATTCAC -3'
Posted On2014-03-14