Mutagenetix > Incidental Mutation

Incidental Mutation 'R1443:Vldlr'

158687

Institutional Source

Beutler Lab

Gene Symbol

Vldlr

Ensembl Gene

ENSMUSG00000024924

Gene Name

very low density lipoprotein receptor

Synonyms

AA408956, AI451093, AW047288, VLDL receptor

MMRRC Submission

039498-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.237) question?

Stock #

R1443 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27216484-27254231 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 27239721 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 348 (I348T)

Ref Sequence

ENSEMBL: ENSMUSP00000049145 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025866] [ENSMUST00000047645] [ENSMUST00000164746] [ENSMUST00000165761] [ENSMUST00000167487] [ENSMUST00000172302]

AlphaFold

P98156

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025866
AA Change: I389T

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000025866
Gene: ENSMUSG00000024924
AA Change: I389T

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_like	32	68	7.38e1	SMART
LDLa	32	69	1.69e-16	SMART
LDLa	71	110	5.81e-15	SMART
LDLa	112	151	1.96e-12	SMART
LDLa	153	190	7.15e-15	SMART
LDLa	192	231	1.23e-13	SMART
LDLa	238	275	1.1e-15	SMART
LDLa	277	314	1.13e-12	SMART
LDLa	317	357	3.86e-11	SMART
EGF_CA	356	395	1e-5	SMART
EGF_CA	396	435	6.1e-10	SMART
Blast:LY	461	495	4e-15	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047645
AA Change: I348T

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000049145
Gene: ENSMUSG00000024924
AA Change: I348T

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_like	32	68	7.38e1	SMART
LDLa	32	69	1.69e-16	SMART
LDLa	71	110	1.25e-14	SMART
LDLa	112	149	7.15e-15	SMART
LDLa	151	190	1.23e-13	SMART
LDLa	197	234	1.1e-15	SMART
LDLa	236	273	1.13e-12	SMART
LDLa	276	316	3.86e-11	SMART
EGF_CA	315	354	1e-5	SMART
EGF_CA	355	394	6.1e-10	SMART
LY	420	462	2.16e-1	SMART
LY	464	506	9.54e-12	SMART
LY	507	550	2.22e-12	SMART
LY	551	593	1.66e-11	SMART
LY	594	637	5.97e-4	SMART
EGF	664	709	2.16e-1	SMART
transmembrane domain	728	750	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164509

Predicted Effect

probably benign
Transcript: ENSMUST00000164746

SMART Domains

Protein: ENSMUSP00000128193
Gene: ENSMUSG00000024924

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
LDLa	32	69	1.69e-16	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000165761
AA Change: I58T

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000130382
Gene: ENSMUSG00000024924
AA Change: I58T

Domain	Start	End	E-Value	Type
LDLa	1	26	1.58e0	SMART
EGF	28	64	4e-5	SMART
LY	88	130	2.16e-1	SMART
LY	132	174	9.54e-12	SMART
LY	175	218	2.22e-12	SMART
LY	219	258	3.25e-5	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167487
AA Change: I389T

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000127329
Gene: ENSMUSG00000024924
AA Change: I389T

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_like	32	68	7.38e1	SMART
LDLa	32	69	1.69e-16	SMART
LDLa	71	110	5.81e-15	SMART
LDLa	112	151	1.96e-12	SMART
LDLa	153	190	7.15e-15	SMART
LDLa	192	231	1.23e-13	SMART
LDLa	238	275	1.1e-15	SMART
LDLa	277	314	1.13e-12	SMART
LDLa	317	357	3.86e-11	SMART
EGF_CA	356	395	1e-5	SMART
EGF_CA	396	435	6.1e-10	SMART
LY	461	503	2.16e-1	SMART
LY	505	547	9.54e-12	SMART
LY	548	591	2.22e-12	SMART
LY	592	634	1.66e-11	SMART
LY	635	678	5.97e-4	SMART
EGF	705	750	2.16e-1	SMART
transmembrane domain	797	819	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172302
AA Change: I389T

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000126730
Gene: ENSMUSG00000024924
AA Change: I389T

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_like	32	68	7.38e1	SMART
LDLa	32	69	1.69e-16	SMART
LDLa	71	110	5.81e-15	SMART
LDLa	112	151	1.96e-12	SMART
LDLa	153	190	7.15e-15	SMART
LDLa	192	231	1.23e-13	SMART
LDLa	238	275	1.1e-15	SMART
LDLa	277	314	1.13e-12	SMART
LDLa	317	357	3.86e-11	SMART
EGF_CA	356	395	1e-5	SMART
EGF_CA	396	435	6.1e-10	SMART
LY	461	503	2.16e-1	SMART
LY	505	547	9.54e-12	SMART
LY	548	591	2.22e-12	SMART
LY	592	634	1.66e-11	SMART
LY	635	678	5.97e-4	SMART
EGF	705	750	2.16e-1	SMART
transmembrane domain	769	791	N/A	INTRINSIC

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.2%
20x: 85.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. This gene encodes a lipoprotein receptor that is a member of the LDLR family and plays important roles in VLDL-triglyceride metabolism and the reelin signaling pathway. Mutations in this gene cause VLDLR-associated cerebellar hypoplasia. Alternative splicing generates multiple transcript variants encoding distinct isoforms for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygous null mutants exhibit modest reductions in body weight and adiposity. In behavioral tests, mutants display deficits in contextual fear conditioning and long term potentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,262,798	S56R	probably damaging	Het
Actr8	A	G	14: 29,984,099	M99V	possibly damaging	Het
Adamtsl2	T	A	2: 27,103,066	C703S	possibly damaging	Het
Afap1	G	T	5: 35,968,661	K333N	probably damaging	Het
Aldh3a2	G	A	11: 61,264,307	S137L	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Aoc1	A	T	6: 48,905,445	K107M	possibly damaging	Het
Bmp8a	G	T	4: 123,316,965	S252R	possibly damaging	Het
C7	T	C	15: 5,059,419	I13M	probably benign	Het
Cblb	T	A	16: 52,139,611	D322E	possibly damaging	Het
Cfap54	G	A	10: 92,932,721	T180I	probably damaging	Het
Clrn2	C	T	5: 45,460,111	A108V	probably damaging	Het
Cspg4	T	A	9: 56,886,512	D510E	probably damaging	Het
Cyp2c40	A	T	19: 39,777,971	N393K	possibly damaging	Het
Dcaf5	T	C	12: 80,364,069	Y294C	probably damaging	Het
Dclk3	T	A	9: 111,469,020	M544K	probably benign	Het
Doxl2	A	T	6: 48,975,915	Y258F	probably damaging	Het
Ell3	A	T	2: 121,439,465	F388I	probably damaging	Het
Fam208b	T	C	13: 3,575,543	K1469R	probably benign	Het
Fam78b	A	G	1: 167,078,760	I163V	probably damaging	Het
Gnptab	T	C	10: 88,434,081	L882P	probably damaging	Het
Herc2	A	T	7: 56,204,733	D3802V	possibly damaging	Het
Hs3st5	A	G	10: 36,833,414	E315G	probably benign	Het
Idh3b	A	T	2: 130,284,054		probably null	Het
Lama4	G	A	10: 39,073,643	E911K	probably damaging	Het
Macf1	A	G	4: 123,511,007	I436T	probably damaging	Het
Mgam	C	A	6: 40,759,780	S871*	probably null	Het
Mtmr7	A	G	8: 40,560,882	S212P	probably damaging	Het
Mylk2	A	G	2: 152,919,416	T480A	probably damaging	Het
Myo3a	A	T	2: 22,282,626	N191I	probably damaging	Het
Nanog	C	T	6: 122,711,775	S105F	probably damaging	Het
Nanos2	A	G	7: 18,987,639	Y12C	probably damaging	Het
Nsg1	C	T	5: 38,155,643	V71I	probably benign	Het
Olfr1368	C	T	13: 21,142,167	V297I	probably benign	Het
Olfr1458	G	T	19: 13,103,204	Y33*	probably null	Het
Olfr1512	A	T	14: 52,372,951	I34N	probably damaging	Het
Olfr211	T	C	6: 116,494,425	L272S	probably benign	Het
Olfr643	A	T	7: 104,058,723	I293N	probably damaging	Het
Pcdhb17	A	G	18: 37,486,648	Q497R	probably benign	Het
Pcsk7	C	A	9: 45,925,986	P536Q	probably damaging	Het
Phactr4	G	A	4: 132,377,248	T256I	probably benign	Het
Phyhip	A	G	14: 70,467,291	K317E	probably damaging	Het
Pkhd1	C	T	1: 20,534,558	G1178R	probably damaging	Het
Ppp1r9a	G	A	6: 5,057,557	G544D	probably damaging	Het
Ptpn3	T	C	4: 57,225,775	D480G	probably benign	Het
Ptprn2	A	T	12: 117,253,615	K918N	probably damaging	Het
Rab42	T	C	4: 132,302,347	D188G	probably benign	Het
Rasgrf2	C	A	13: 91,983,676	D20Y	probably damaging	Het
Ryr2	G	A	13: 11,779,266	T942I	probably benign	Het
Sbpl	T	C	17: 23,953,354	K197R	unknown	Het
Slc44a1	T	A	4: 53,561,069	V595E	probably damaging	Het
Slc6a19	A	G	13: 73,684,344	M410T	probably damaging	Het
Sntb1	A	T	15: 55,647,955	L411H	probably damaging	Het
Synj2	A	G	17: 6,023,665	K245E	probably damaging	Het
Tmem131	G	A	1: 36,825,478	T558I	probably damaging	Het
Tnrc18	A	T	5: 142,771,533	S1078T	unknown	Het
Trmu	T	A	15: 85,897,101		probably null	Het
Ttn	A	T	2: 76,891,086		probably benign	Het
Tyw3	T	C	3: 154,587,523	T172A	probably benign	Het
Zfp114	A	G	7: 24,177,769	D12G	probably damaging	Het

Other mutations in Vldlr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01346:Vldlr	APN	19	27239681	missense	possibly damaging	0.93
IGL01575:Vldlr	APN	19	27246631	missense	probably benign
IGL01626:Vldlr	APN	19	27243773	missense	probably damaging	1.00
IGL02213:Vldlr	APN	19	27241326	missense	probably benign	0.09
IGL02365:Vldlr	APN	19	27245625	missense	probably damaging	1.00
IGL02488:Vldlr	APN	19	27238275	missense	probably damaging	1.00
IGL02708:Vldlr	APN	19	27238085	missense	possibly damaging	0.92
IGL02947:Vldlr	APN	19	27239720	missense	probably benign	0.03
disturbed	UTSW	19	27238804	nonsense	probably null
r26	UTSW	19	27245654	missense	probably damaging	0.99
spotty	UTSW	19	27238792	missense	probably damaging	1.00
PIT4142001:Vldlr	UTSW	19	27234869	missense	probably benign	0.05
R0195:Vldlr	UTSW	19	27238386	missense	probably damaging	1.00
R0288:Vldlr	UTSW	19	27240651	splice site	probably benign
R0536:Vldlr	UTSW	19	27239964	missense	probably damaging	1.00
R0537:Vldlr	UTSW	19	27247918	missense	probably damaging	1.00
R0542:Vldlr	UTSW	19	27236255	missense	probably benign	0.01
R0594:Vldlr	UTSW	19	27234819	missense	probably damaging	1.00
R0624:Vldlr	UTSW	19	27238263	missense	possibly damaging	0.91
R0726:Vldlr	UTSW	19	27238386	missense	probably damaging	1.00
R1017:Vldlr	UTSW	19	27241333	missense	probably damaging	1.00
R1148:Vldlr	UTSW	19	27241291	missense	probably benign	0.01
R1148:Vldlr	UTSW	19	27241291	missense	probably benign	0.01
R1493:Vldlr	UTSW	19	27241291	missense	probably benign	0.01
R1520:Vldlr	UTSW	19	27240543	missense	probably damaging	0.99
R1520:Vldlr	UTSW	19	27247066	missense	possibly damaging	0.96
R1657:Vldlr	UTSW	19	27245670	missense	probably benign	0.00
R1901:Vldlr	UTSW	19	27241309	missense	probably damaging	1.00
R2047:Vldlr	UTSW	19	27234838	missense	probably damaging	1.00
R2258:Vldlr	UTSW	19	27238386	missense	probably damaging	1.00
R2273:Vldlr	UTSW	19	27248015	missense	probably damaging	1.00
R2423:Vldlr	UTSW	19	27236288	missense	possibly damaging	0.49
R3196:Vldlr	UTSW	19	27243154	missense	probably damaging	0.98
R3752:Vldlr	UTSW	19	27238331	missense	probably damaging	1.00
R3801:Vldlr	UTSW	19	27217621	missense	probably damaging	0.99
R3835:Vldlr	UTSW	19	27234814	missense	probably damaging	1.00
R4027:Vldlr	UTSW	19	27238313	missense	probably benign
R4301:Vldlr	UTSW	19	27238402	missense	possibly damaging	0.80
R4470:Vldlr	UTSW	19	27234819	missense	probably damaging	0.96
R4541:Vldlr	UTSW	19	27238792	missense	probably damaging	1.00
R4765:Vldlr	UTSW	19	27240547	missense	probably damaging	1.00
R4771:Vldlr	UTSW	19	27239890	missense	probably damaging	0.97
R4795:Vldlr	UTSW	19	27238852	splice site	probably null
R4839:Vldlr	UTSW	19	27238065	missense	probably damaging	1.00
R5074:Vldlr	UTSW	19	27238277	missense	probably damaging	1.00
R5134:Vldlr	UTSW	19	27238812	nonsense	probably null
R5281:Vldlr	UTSW	19	27244231	missense	probably benign	0.44
R5466:Vldlr	UTSW	19	27239843	critical splice acceptor site	probably null
R5514:Vldlr	UTSW	19	27244224	missense	probably damaging	0.97
R5886:Vldlr	UTSW	19	27243771	missense	probably benign	0.03
R5889:Vldlr	UTSW	19	27239664	missense	probably damaging	1.00
R6110:Vldlr	UTSW	19	27238077	missense	possibly damaging	0.92
R6343:Vldlr	UTSW	19	27245649	missense	probably damaging	0.99
R6833:Vldlr	UTSW	19	27240574	missense	probably damaging	1.00
R6838:Vldlr	UTSW	19	27247970	missense	probably damaging	1.00
R7169:Vldlr	UTSW	19	27244328	missense	probably benign
R7197:Vldlr	UTSW	19	27234841	missense	probably benign	0.36
R7304:Vldlr	UTSW	19	27238604	missense	possibly damaging	0.93
R7403:Vldlr	UTSW	19	27236274	nonsense	probably null
R7658:Vldlr	UTSW	19	27243136	missense	probably benign	0.33
R7754:Vldlr	UTSW	19	27217615	start codon destroyed	probably benign	0.01
R8105:Vldlr	UTSW	19	27238804	nonsense	probably null
R8377:Vldlr	UTSW	19	27234858	missense	probably damaging	1.00
R8529:Vldlr	UTSW	19	27230256	missense	probably benign	0.03
R8777:Vldlr	UTSW	19	27240546	missense	probably benign	0.00
R8777-TAIL:Vldlr	UTSW	19	27240546	missense	probably benign	0.00
R9380:Vldlr	UTSW	19	27238792	missense	possibly damaging	0.63
R9400:Vldlr	UTSW	19	27238775	missense	probably damaging	0.99
R9483:Vldlr	UTSW	19	27246631	missense	probably benign	0.00
R9502:Vldlr	UTSW	19	27241342	missense	probably damaging	1.00
R9509:Vldlr	UTSW	19	27244287	missense	probably benign	0.44
R9630:Vldlr	UTSW	19	27230223	missense	probably damaging	1.00
R9767:Vldlr	UTSW	19	27234874	missense	probably damaging	1.00
R9768:Vldlr	UTSW	19	27241320	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- ACCAATAGCCGGAGACTGAATGTGA -3'
(R):5'- GCAAGATCCATTTGATAGCCACGACT -3'

Sequencing Primer
(F):5'- tgggaggcagaggcagg -3'
(R):5'- TTTGATAGCCACGACTACATTCAC -3'

Posted On

2014-03-14