Incidental Mutation 'R1445:Kcnq5'
ID158744
Institutional Source Beutler Lab
Gene Symbol Kcnq5
Ensembl Gene ENSMUSG00000028033
Gene Namepotassium voltage-gated channel, subfamily Q, member 5
Synonyms9230107O05Rik, D1Mgi1
MMRRC Submission 039500-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.612) question?
Stock #R1445 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location21398403-21961942 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 21405024 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 473 (S473A)
Ref Sequence ENSEMBL: ENSMUSP00000134166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029667] [ENSMUST00000115300] [ENSMUST00000173058] [ENSMUST00000173404] [ENSMUST00000174183]
Predicted Effect probably benign
Transcript: ENSMUST00000029667
AA Change: S583A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029667
Gene: ENSMUSG00000028033
AA Change: S583A

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Ion_trans 163 347 1.7e-26 PFAM
Pfam:Ion_trans_2 272 352 5.3e-15 PFAM
Pfam:KCNQ_channel 446 648 3.6e-95 PFAM
low complexity region 848 858 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115300
AA Change: S602A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110955
Gene: ENSMUSG00000028033
AA Change: S602A

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
Pfam:Ion_trans 126 359 4.1e-28 PFAM
Pfam:Ion_trans_2 272 352 3.3e-16 PFAM
Pfam:KCNQ_channel 467 661 1.8e-98 PFAM
low complexity region 867 877 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173058
AA Change: S473A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000134166
Gene: ENSMUSG00000028033
AA Change: S473A

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Ion_trans 163 347 2e-26 PFAM
Pfam:Ion_trans_2 272 352 3.1e-15 PFAM
Pfam:KCNQ_channel 405 538 8e-64 PFAM
low complexity region 738 748 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173404
AA Change: S574A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134076
Gene: ENSMUSG00000028033
AA Change: S574A

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Ion_trans 163 347 2.4e-26 PFAM
Pfam:Ion_trans_2 272 352 3.6e-15 PFAM
Pfam:KCNQ_channel 437 639 2e-95 PFAM
low complexity region 839 849 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174183
SMART Domains Protein: ENSMUSP00000134389
Gene: ENSMUSG00000028033

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Meta Mutation Damage Score 0.0725 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.9%
  • 20x: 84.0%
Validation Efficiency 96% (101/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the KCNQ potassium channel gene family that is differentially expressed in subregions of the brain and in skeletal muscle. The protein encoded by this gene yields currents that activate slowly with depolarization and can form heteromeric channels with the protein encoded by the KCNQ3 gene. Currents expressed from this protein have voltage dependences and inhibitor sensitivities in common with M-currents. They are also inhibited by M1 muscarinic receptor activation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a dominant negative knock-in mutation in this gene exhibit partial prenatal lethality and abnormal afterhyperpolarization in the in the CA3 area of hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061I17Rik G T 3: 117,067,736 noncoding transcript Het
2300003K06Rik G T 11: 99,837,967 Q17K probably benign Het
Abca16 T C 7: 120,520,033 V999A probably benign Het
Actn3 C T 19: 4,865,455 probably benign Het
Agap2 T A 10: 127,091,112 probably benign Het
Ago3 C A 4: 126,371,787 R278L probably benign Het
Aldh1a2 T C 9: 71,285,210 V449A possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aplnr A G 2: 85,137,009 Y126C probably damaging Het
Apob T C 12: 8,016,084 I4351T possibly damaging Het
Ash1l T C 3: 89,007,352 L1763P probably benign Het
Aspn T C 13: 49,557,373 S165P possibly damaging Het
Atg13 A T 2: 91,679,990 V349E probably damaging Het
Atp1b2 T A 11: 69,602,483 probably null Het
B3glct A T 5: 149,754,139 D411V probably damaging Het
Bcar3 A T 3: 122,523,191 I255F probably damaging Het
Cacna1b G A 2: 24,718,136 probably benign Het
Cep164 T G 9: 45,778,900 E675A possibly damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Chst8 C A 7: 34,748,168 M8I possibly damaging Het
Clec4n A G 6: 123,235,516 E67G probably benign Het
Cobll1 A T 2: 65,099,136 D653E probably damaging Het
Col9a1 T C 1: 24,237,498 probably null Het
Crip2 T C 12: 113,143,504 L30P probably damaging Het
Ctbp1 C T 5: 33,261,063 V22I probably benign Het
Cwc22 T C 2: 77,917,177 probably benign Het
Cyp4a32 C A 4: 115,602,950 Y119* probably null Het
Dido1 G T 2: 180,671,470 A463E possibly damaging Het
Dnah7a G A 1: 53,528,797 P1880L probably benign Het
Dock2 T A 11: 34,239,705 T1489S probably benign Het
Dsp A G 13: 38,191,931 T1231A probably damaging Het
Eif2ak1 G T 5: 143,873,899 probably benign Het
Epc1 A T 18: 6,452,360 M233K probably damaging Het
Fam189a2 G A 19: 24,021,634 T140M probably damaging Het
Gigyf2 A G 1: 87,443,638 probably benign Het
Greb1 T G 12: 16,707,851 H58P probably damaging Het
Gtpbp1 T C 15: 79,713,448 I348T possibly damaging Het
Hck A T 2: 153,128,272 N64Y probably benign Het
Herc2 T C 7: 56,168,996 S2812P probably damaging Het
Inpp4b T A 8: 81,952,834 probably null Het
Lrat T G 3: 82,903,369 D115A probably damaging Het
Lyst A G 13: 13,640,054 I1131M possibly damaging Het
Man2a2 T C 7: 80,368,562 D160G probably benign Het
Marf1 C T 16: 14,115,824 D1567N probably benign Het
Mars T C 10: 127,297,988 D680G possibly damaging Het
Mat1a T C 14: 41,121,840 S339P probably damaging Het
Megf8 T C 7: 25,342,656 S1300P probably damaging Het
Mga T C 2: 119,902,698 L9S probably damaging Het
Mllt6 T C 11: 97,672,451 probably benign Het
Mrpl37 A G 4: 107,064,495 L179P probably benign Het
Mtnr1a G T 8: 45,087,745 V248L probably benign Het
Mylk T C 16: 34,815,465 S19P possibly damaging Het
Olfr738 A G 14: 50,414,401 T286A probably damaging Het
Parp8 A T 13: 117,025,350 probably null Het
Pcnx2 T C 8: 125,752,284 D2075G probably damaging Het
Pigo A T 4: 43,021,460 I494K probably benign Het
Pkd1l1 A T 11: 8,870,313 D1217E probably benign Het
Pkhd1l1 T C 15: 44,505,644 V895A probably benign Het
Plcb4 A T 2: 136,000,189 H1031L possibly damaging Het
Plxnb1 A G 9: 109,108,921 K1245R probably null Het
Pold1 C T 7: 44,542,757 probably benign Het
Ptprq T C 10: 107,662,562 I885V probably damaging Het
Ptprz1 A G 6: 23,050,474 D1398G probably damaging Het
Pygm G A 19: 6,389,887 A364T probably benign Het
Rbl1 T C 2: 157,193,098 N354S probably benign Het
Scgb2b19 C T 7: 33,279,612 probably null Het
Slc26a8 C T 17: 28,648,213 V545M possibly damaging Het
Slc27a1 T A 8: 71,584,113 probably null Het
Smpd1 A G 7: 105,556,674 D416G possibly damaging Het
Sorbs3 A G 14: 70,193,646 V284A probably benign Het
Stfa2l1 T C 16: 36,161,784 V75A probably damaging Het
Syndig1 A G 2: 149,930,921 D166G probably damaging Het
Tcp10a G A 17: 7,326,007 probably null Het
Themis2 T A 4: 132,782,901 I663F possibly damaging Het
Thrap3 T C 4: 126,176,336 Q586R probably damaging Het
Tinag C A 9: 77,045,516 C62F probably damaging Het
Tmem206 A G 1: 191,348,362 probably benign Het
Tmod1 T C 4: 46,090,884 Y146H probably damaging Het
Tmprss4 T A 9: 45,184,385 I54F possibly damaging Het
Tnks A C 8: 34,834,603 probably benign Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Trpc6 A G 9: 8,680,537 E844G probably benign Het
Ubtd2 C T 11: 32,516,125 R115W probably damaging Het
Ubxn6 T C 17: 56,069,042 D373G probably benign Het
Upf1 T A 8: 70,341,524 Q244L probably benign Het
Usp33 A G 3: 152,368,634 I372M probably damaging Het
Usp34 A G 11: 23,351,629 E351G probably damaging Het
Utrn A G 10: 12,678,574 probably benign Het
Vmn1r78 A G 7: 12,152,581 K40E possibly damaging Het
Vmn2r7 T A 3: 64,724,802 M80L probably benign Het
Vps13a G T 19: 16,701,238 Y1126* probably null Het
Wfdc11 T C 2: 164,664,446 N60S probably benign Het
Wnk2 C T 13: 49,071,110 D992N probably damaging Het
Zpbp2 C A 11: 98,553,844 T66K probably damaging Het
Other mutations in Kcnq5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Kcnq5 APN 1 21505763 missense probably damaging 1.00
IGL01603:Kcnq5 APN 1 21505340 missense possibly damaging 0.94
IGL02326:Kcnq5 APN 1 21402592 missense probably benign 0.17
IGL02624:Kcnq5 APN 1 21402430 missense probably benign 0.27
IGL03151:Kcnq5 APN 1 21535069 missense probably damaging 1.00
IGL03367:Kcnq5 APN 1 21403065 missense probably damaging 1.00
PIT1430001:Kcnq5 UTSW 1 21535181 missense probably damaging 1.00
R0705:Kcnq5 UTSW 1 21535177 missense probably damaging 1.00
R0798:Kcnq5 UTSW 1 21961175 splice site probably null
R1263:Kcnq5 UTSW 1 21479378 missense probably damaging 1.00
R1465:Kcnq5 UTSW 1 21469468 critical splice donor site probably null
R1465:Kcnq5 UTSW 1 21469468 critical splice donor site probably null
R1497:Kcnq5 UTSW 1 21402386 missense possibly damaging 0.82
R1515:Kcnq5 UTSW 1 21402681 missense probably benign 0.01
R1610:Kcnq5 UTSW 1 21457461 missense probably damaging 1.00
R1835:Kcnq5 UTSW 1 21466387 missense probably benign 0.04
R1999:Kcnq5 UTSW 1 21402204 missense probably null 0.18
R2060:Kcnq5 UTSW 1 21461597 missense probably benign 0.06
R2145:Kcnq5 UTSW 1 21505349 missense probably damaging 0.96
R2314:Kcnq5 UTSW 1 21479371 splice site probably null
R2511:Kcnq5 UTSW 1 21505782 nonsense probably null
R2697:Kcnq5 UTSW 1 21479432 missense probably damaging 1.00
R2886:Kcnq5 UTSW 1 21469547 nonsense probably null
R2889:Kcnq5 UTSW 1 21402302 missense probably damaging 0.98
R4176:Kcnq5 UTSW 1 21535168 missense probably damaging 1.00
R4609:Kcnq5 UTSW 1 21405068 splice site probably null
R4720:Kcnq5 UTSW 1 21403050 missense probably damaging 0.96
R4904:Kcnq5 UTSW 1 21424100 missense probably damaging 0.98
R5184:Kcnq5 UTSW 1 21402487 missense probably damaging 1.00
R5268:Kcnq5 UTSW 1 21505725 missense probably damaging 1.00
R5373:Kcnq5 UTSW 1 21961571 missense unknown
R5397:Kcnq5 UTSW 1 21405856 missense probably damaging 1.00
R5473:Kcnq5 UTSW 1 21457402 critical splice donor site probably null
R5490:Kcnq5 UTSW 1 21479468 missense probably damaging 1.00
R5946:Kcnq5 UTSW 1 21505707 missense probably damaging 1.00
R6941:Kcnq5 UTSW 1 21405844 missense probably damaging 1.00
R6962:Kcnq5 UTSW 1 21505793 missense probably damaging 1.00
R7201:Kcnq5 UTSW 1 21402875 missense possibly damaging 0.93
R7238:Kcnq5 UTSW 1 21402302 missense probably benign 0.39
R7375:Kcnq5 UTSW 1 21469486 missense possibly damaging 0.82
R7584:Kcnq5 UTSW 1 21402321 missense probably benign
R7780:Kcnq5 UTSW 1 21961331 missense probably benign 0.43
Z1088:Kcnq5 UTSW 1 21457529 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGAAGTTGCAGATACTCTGCC -3'
(R):5'- TGGACAGTTTCCCTCTAGACGCTC -3'

Sequencing Primer
(F):5'- CTGCCTTGATGAATGAATCCCAG -3'
(R):5'- aacacttgctgctcctcc -3'
Posted On2014-03-14