Incidental Mutation 'R1445:Utrn'
ID158800
Institutional Source Beutler Lab
Gene Symbol Utrn
Ensembl Gene ENSMUSG00000019820
Gene Nameutrophin
SynonymsG-utrophin, DRP, Dmdl
MMRRC Submission 039500-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1445 (G1)
Quality Score150
Status Validated
Chromosome10
Chromosomal Location12382188-12869365 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 12678574 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076817] [ENSMUST00000218635]
Predicted Effect probably benign
Transcript: ENSMUST00000076817
SMART Domains Protein: ENSMUSP00000076093
Gene: ENSMUSG00000019820

DomainStartEndE-ValueType
CH 33 133 1.87e-24 SMART
CH 152 250 4.05e-20 SMART
SPEC 312 416 2.31e-18 SMART
SPEC 421 525 4.18e-16 SMART
SPEC 532 636 3.35e-6 SMART
low complexity region 665 679 N/A INTRINSIC
SPEC 690 795 1.7e-7 SMART
SPEC 801 901 1e-4 SMART
SPEC 910 1012 8.24e-2 SMART
SPEC 1019 1121 1.32e-4 SMART
SPEC 1128 1229 2.64e-4 SMART
SPEC 1236 1333 4.42e-6 SMART
coiled coil region 1375 1401 N/A INTRINSIC
SPEC 1438 1540 3.62e-2 SMART
SPEC 1547 1648 7.95e-1 SMART
SPEC 1655 1752 3.56e0 SMART
coiled coil region 1766 1795 N/A INTRINSIC
SPEC 1870 1972 3.63e0 SMART
SPEC 1979 2080 5.15e-16 SMART
SPEC 2087 2183 3.71e0 SMART
SPEC 2227 2330 4.7e-10 SMART
SPEC 2337 2437 1.02e0 SMART
SPEC 2444 2553 2.35e-10 SMART
SPEC 2560 2685 8.77e-10 SMART
SPEC 2692 2794 4.13e-6 SMART
WW 2811 2843 5.59e-7 SMART
Pfam:EF-hand_2 2844 2962 3.8e-41 PFAM
Pfam:EF-hand_3 2966 3057 1.6e-39 PFAM
ZnF_ZZ 3062 3107 6.33e-17 SMART
coiled coil region 3250 3289 N/A INTRINSIC
coiled coil region 3310 3354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219724
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.9%
  • 20x: 84.0%
Validation Efficiency 96% (101/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene shares both structural and functional similarities with the dystrophin gene. It contains an actin-binding N-terminus, a triple coiled-coil repeat central region, and a C-terminus that consists of protein-protein interaction motifs which interact with dystroglycan protein components. The protein encoded by this gene is located at the neuromuscular synapse and myotendinous junctions, where it participates in post-synaptic membrane maintenance and acetylcholine receptor clustering. Mouse studies suggest that this gene may serve as a functional substitute for the dystrophin gene and therefore, may serve as a potential therapeutic alternative to muscular dystrophy which is caused by mutations in the dystrophin gene. Alternative splicing of the utrophin gene has been described; however, the full-length nature of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have reduced density of acetylcholine receptors and reduced number of junctional folds at neuromuscular junctions. Mice homozygous for utrophin and dystrophin knockouts die prematurely with severe, progressive muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061I17Rik G T 3: 117,067,736 noncoding transcript Het
2300003K06Rik G T 11: 99,837,967 Q17K probably benign Het
Abca16 T C 7: 120,520,033 V999A probably benign Het
Actn3 C T 19: 4,865,455 probably benign Het
Agap2 T A 10: 127,091,112 probably benign Het
Ago3 C A 4: 126,371,787 R278L probably benign Het
Aldh1a2 T C 9: 71,285,210 V449A possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aplnr A G 2: 85,137,009 Y126C probably damaging Het
Apob T C 12: 8,016,084 I4351T possibly damaging Het
Ash1l T C 3: 89,007,352 L1763P probably benign Het
Aspn T C 13: 49,557,373 S165P possibly damaging Het
Atg13 A T 2: 91,679,990 V349E probably damaging Het
Atp1b2 T A 11: 69,602,483 probably null Het
B3glct A T 5: 149,754,139 D411V probably damaging Het
Bcar3 A T 3: 122,523,191 I255F probably damaging Het
Cacna1b G A 2: 24,718,136 probably benign Het
Cep164 T G 9: 45,778,900 E675A possibly damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Chst8 C A 7: 34,748,168 M8I possibly damaging Het
Clec4n A G 6: 123,235,516 E67G probably benign Het
Cobll1 A T 2: 65,099,136 D653E probably damaging Het
Col9a1 T C 1: 24,237,498 probably null Het
Crip2 T C 12: 113,143,504 L30P probably damaging Het
Ctbp1 C T 5: 33,261,063 V22I probably benign Het
Cwc22 T C 2: 77,917,177 probably benign Het
Cyp4a32 C A 4: 115,602,950 Y119* probably null Het
Dido1 G T 2: 180,671,470 A463E possibly damaging Het
Dnah7a G A 1: 53,528,797 P1880L probably benign Het
Dock2 T A 11: 34,239,705 T1489S probably benign Het
Dsp A G 13: 38,191,931 T1231A probably damaging Het
Eif2ak1 G T 5: 143,873,899 probably benign Het
Epc1 A T 18: 6,452,360 M233K probably damaging Het
Fam189a2 G A 19: 24,021,634 T140M probably damaging Het
Gigyf2 A G 1: 87,443,638 probably benign Het
Greb1 T G 12: 16,707,851 H58P probably damaging Het
Gtpbp1 T C 15: 79,713,448 I348T possibly damaging Het
Hck A T 2: 153,128,272 N64Y probably benign Het
Herc2 T C 7: 56,168,996 S2812P probably damaging Het
Inpp4b T A 8: 81,952,834 probably null Het
Kcnq5 A C 1: 21,405,024 S473A probably benign Het
Lrat T G 3: 82,903,369 D115A probably damaging Het
Lyst A G 13: 13,640,054 I1131M possibly damaging Het
Man2a2 T C 7: 80,368,562 D160G probably benign Het
Marf1 C T 16: 14,115,824 D1567N probably benign Het
Mars T C 10: 127,297,988 D680G possibly damaging Het
Mat1a T C 14: 41,121,840 S339P probably damaging Het
Megf8 T C 7: 25,342,656 S1300P probably damaging Het
Mga T C 2: 119,902,698 L9S probably damaging Het
Mllt6 T C 11: 97,672,451 probably benign Het
Mrpl37 A G 4: 107,064,495 L179P probably benign Het
Mtnr1a G T 8: 45,087,745 V248L probably benign Het
Mylk T C 16: 34,815,465 S19P possibly damaging Het
Olfr738 A G 14: 50,414,401 T286A probably damaging Het
Parp8 A T 13: 117,025,350 probably null Het
Pcnx2 T C 8: 125,752,284 D2075G probably damaging Het
Pigo A T 4: 43,021,460 I494K probably benign Het
Pkd1l1 A T 11: 8,870,313 D1217E probably benign Het
Pkhd1l1 T C 15: 44,505,644 V895A probably benign Het
Plcb4 A T 2: 136,000,189 H1031L possibly damaging Het
Plxnb1 A G 9: 109,108,921 K1245R probably null Het
Pold1 C T 7: 44,542,757 probably benign Het
Ptprq T C 10: 107,662,562 I885V probably damaging Het
Ptprz1 A G 6: 23,050,474 D1398G probably damaging Het
Pygm G A 19: 6,389,887 A364T probably benign Het
Rbl1 T C 2: 157,193,098 N354S probably benign Het
Scgb2b19 C T 7: 33,279,612 probably null Het
Slc26a8 C T 17: 28,648,213 V545M possibly damaging Het
Slc27a1 T A 8: 71,584,113 probably null Het
Smpd1 A G 7: 105,556,674 D416G possibly damaging Het
Sorbs3 A G 14: 70,193,646 V284A probably benign Het
Stfa2l1 T C 16: 36,161,784 V75A probably damaging Het
Syndig1 A G 2: 149,930,921 D166G probably damaging Het
Tcp10a G A 17: 7,326,007 probably null Het
Themis2 T A 4: 132,782,901 I663F possibly damaging Het
Thrap3 T C 4: 126,176,336 Q586R probably damaging Het
Tinag C A 9: 77,045,516 C62F probably damaging Het
Tmem206 A G 1: 191,348,362 probably benign Het
Tmod1 T C 4: 46,090,884 Y146H probably damaging Het
Tmprss4 T A 9: 45,184,385 I54F possibly damaging Het
Tnks A C 8: 34,834,603 probably benign Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Trpc6 A G 9: 8,680,537 E844G probably benign Het
Ubtd2 C T 11: 32,516,125 R115W probably damaging Het
Ubxn6 T C 17: 56,069,042 D373G probably benign Het
Upf1 T A 8: 70,341,524 Q244L probably benign Het
Usp33 A G 3: 152,368,634 I372M probably damaging Het
Usp34 A G 11: 23,351,629 E351G probably damaging Het
Vmn1r78 A G 7: 12,152,581 K40E possibly damaging Het
Vmn2r7 T A 3: 64,724,802 M80L probably benign Het
Vps13a G T 19: 16,701,238 Y1126* probably null Het
Wfdc11 T C 2: 164,664,446 N60S probably benign Het
Wnk2 C T 13: 49,071,110 D992N probably damaging Het
Zpbp2 C A 11: 98,553,844 T66K probably damaging Het
Other mutations in Utrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Utrn APN 10 12671830 missense probably damaging 1.00
IGL00469:Utrn APN 10 12406529 missense probably damaging 1.00
IGL00518:Utrn APN 10 12666843 splice site probably benign
IGL00560:Utrn APN 10 12455467 nonsense probably null
IGL00589:Utrn APN 10 12678618 missense possibly damaging 0.53
IGL00662:Utrn APN 10 12664961 missense probably damaging 0.99
IGL00754:Utrn APN 10 12663492 missense probably benign 0.05
IGL00772:Utrn APN 10 12649185 missense probably benign
IGL00775:Utrn APN 10 12745230 critical splice donor site probably null
IGL00782:Utrn APN 10 12652811 missense probably benign 0.13
IGL00962:Utrn APN 10 12481334 missense possibly damaging 0.80
IGL01584:Utrn APN 10 12726367 missense probably benign 0.01
IGL01677:Utrn APN 10 12744157 missense probably damaging 1.00
IGL01695:Utrn APN 10 12745342 missense probably benign 0.00
IGL01743:Utrn APN 10 12711557 missense possibly damaging 0.94
IGL01815:Utrn APN 10 12652716 missense probably benign 0.00
IGL01901:Utrn APN 10 12640928 missense probably damaging 1.00
IGL01982:Utrn APN 10 12748029 missense probably damaging 1.00
IGL01983:Utrn APN 10 12669781 missense probably benign 0.18
IGL02031:Utrn APN 10 12735204 missense probably damaging 1.00
IGL02106:Utrn APN 10 12413973 missense possibly damaging 0.92
IGL02134:Utrn APN 10 12643419 missense probably damaging 0.99
IGL02209:Utrn APN 10 12683295 missense probably damaging 0.97
IGL02217:Utrn APN 10 12751559 missense probably damaging 1.00
IGL02250:Utrn APN 10 12436391 missense probably damaging 1.00
IGL02307:Utrn APN 10 12750065 nonsense probably null
IGL02386:Utrn APN 10 12421608 missense possibly damaging 0.91
IGL02494:Utrn APN 10 12710054 missense probably benign
IGL02631:Utrn APN 10 12710063 missense probably benign 0.00
IGL02729:Utrn APN 10 12720810 unclassified probably benign
IGL02736:Utrn APN 10 12421640 missense probably damaging 1.00
IGL02832:Utrn APN 10 12738193 missense possibly damaging 0.82
IGL02926:Utrn APN 10 12690760 missense probably damaging 0.96
IGL03184:Utrn APN 10 12710166 missense probably benign 0.04
IGL03194:Utrn APN 10 12406429 splice site probably benign
IGL03346:Utrn APN 10 12525352 missense probably benign 0.22
shrinking_violet UTSW 10 12711585 critical splice acceptor site probably null
Wallflower UTSW 10 12747975 missense probably damaging 1.00
FR4548:Utrn UTSW 10 12633941 critical splice donor site probably benign
I2288:Utrn UTSW 10 12421640 missense probably damaging 1.00
PIT4677001:Utrn UTSW 10 12666704 missense probably benign 0.06
R0022:Utrn UTSW 10 12709956 splice site probably benign
R0024:Utrn UTSW 10 12406011 missense probably benign 0.00
R0024:Utrn UTSW 10 12406011 missense probably benign 0.00
R0026:Utrn UTSW 10 12726196 splice site probably benign
R0026:Utrn UTSW 10 12726196 splice site probably benign
R0091:Utrn UTSW 10 12735204 missense probably damaging 1.00
R0112:Utrn UTSW 10 12686465 nonsense probably null
R0126:Utrn UTSW 10 12711475 missense probably benign 0.02
R0184:Utrn UTSW 10 12667618 missense probably benign
R0219:Utrn UTSW 10 12684451 missense probably damaging 1.00
R0369:Utrn UTSW 10 12634022 missense probably benign 0.37
R0390:Utrn UTSW 10 12710060 missense probably benign 0.05
R0391:Utrn UTSW 10 12525333 splice site probably benign
R0408:Utrn UTSW 10 12384190 makesense probably null
R0409:Utrn UTSW 10 12643601 missense probably benign 0.01
R0441:Utrn UTSW 10 12688294 missense probably null 0.88
R0504:Utrn UTSW 10 12402895 missense probably benign 0.02
R0730:Utrn UTSW 10 12698158 splice site probably benign
R1078:Utrn UTSW 10 12455566 critical splice acceptor site probably null
R1171:Utrn UTSW 10 12481308 missense probably damaging 0.99
R1191:Utrn UTSW 10 12634033 missense probably benign 0.02
R1203:Utrn UTSW 10 12486537 missense probably damaging 1.00
R1401:Utrn UTSW 10 12649153 missense probably benign
R1418:Utrn UTSW 10 12713350 missense probably benign
R1439:Utrn UTSW 10 12744049 missense possibly damaging 0.79
R1441:Utrn UTSW 10 12683295 missense probably damaging 0.97
R1509:Utrn UTSW 10 12455441 missense possibly damaging 0.91
R1546:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1585:Utrn UTSW 10 12436285 missense possibly damaging 0.62
R1621:Utrn UTSW 10 12713283 missense probably benign 0.24
R1637:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1703:Utrn UTSW 10 12727729 splice site probably benign
R1725:Utrn UTSW 10 12663519 missense probably damaging 0.99
R1735:Utrn UTSW 10 12710138 missense probably benign
R1770:Utrn UTSW 10 12475296 missense probably damaging 0.98
R1778:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1783:Utrn UTSW 10 12463339 missense probably damaging 1.00
R1818:Utrn UTSW 10 12709964 critical splice donor site probably null
R1829:Utrn UTSW 10 12475274 missense probably damaging 1.00
R1919:Utrn UTSW 10 12455480 missense probably benign 0.15
R1964:Utrn UTSW 10 12684437 missense probably damaging 1.00
R2080:Utrn UTSW 10 12737082 missense probably benign 0.36
R2092:Utrn UTSW 10 12678698 missense probably benign 0.12
R2107:Utrn UTSW 10 12436364 missense probably damaging 1.00
R2108:Utrn UTSW 10 12436364 missense probably damaging 1.00
R2760:Utrn UTSW 10 12690878 missense probably damaging 1.00
R2884:Utrn UTSW 10 12739361 splice site probably null
R2885:Utrn UTSW 10 12739361 splice site probably null
R2886:Utrn UTSW 10 12739361 splice site probably null
R2903:Utrn UTSW 10 12643428 missense probably damaging 1.00
R2944:Utrn UTSW 10 12643419 missense probably damaging 1.00
R2945:Utrn UTSW 10 12486391 missense possibly damaging 0.50
R3438:Utrn UTSW 10 12481318 missense probably damaging 0.98
R3683:Utrn UTSW 10 12666835 missense probably benign 0.10
R3735:Utrn UTSW 10 12478484 missense probably damaging 1.00
R3907:Utrn UTSW 10 12710182 splice site probably benign
R3923:Utrn UTSW 10 12739479 missense probably benign 0.23
R3925:Utrn UTSW 10 12698042 missense probably benign
R3926:Utrn UTSW 10 12698042 missense probably benign
R3938:Utrn UTSW 10 12750030 critical splice donor site probably null
R3941:Utrn UTSW 10 12711585 critical splice acceptor site probably null
R3958:Utrn UTSW 10 12750108 missense probably damaging 1.00
R4091:Utrn UTSW 10 12710171 missense probably benign 0.10
R4454:Utrn UTSW 10 12727840 missense possibly damaging 0.81
R4585:Utrn UTSW 10 12688306 missense probably benign 0.01
R4667:Utrn UTSW 10 12698053 missense probably benign 0.22
R4684:Utrn UTSW 10 12745240 missense probably damaging 1.00
R4782:Utrn UTSW 10 12750069 missense probably damaging 1.00
R4785:Utrn UTSW 10 12654745 missense probably benign 0.39
R4799:Utrn UTSW 10 12750069 missense probably damaging 1.00
R4829:Utrn UTSW 10 12663461 missense probably benign 0.00
R4878:Utrn UTSW 10 12727758 missense probably damaging 1.00
R4955:Utrn UTSW 10 12861567 critical splice donor site probably null
R4967:Utrn UTSW 10 12455420 missense probably damaging 0.99
R5071:Utrn UTSW 10 12384204 splice site probably null
R5072:Utrn UTSW 10 12384204 splice site probably null
R5186:Utrn UTSW 10 12728777 missense probably damaging 1.00
R5213:Utrn UTSW 10 12636760 missense probably damaging 1.00
R5296:Utrn UTSW 10 12401355 missense probably damaging 1.00
R5309:Utrn UTSW 10 12727769 missense probably damaging 1.00
R5312:Utrn UTSW 10 12727769 missense probably damaging 1.00
R5399:Utrn UTSW 10 12640983 missense probably damaging 1.00
R5407:Utrn UTSW 10 12680625 missense probably damaging 1.00
R5411:Utrn UTSW 10 12649185 missense probably benign
R5428:Utrn UTSW 10 12693431 missense probably benign 0.09
R5595:Utrn UTSW 10 12682318 missense possibly damaging 0.89
R5602:Utrn UTSW 10 12750095 missense probably damaging 1.00
R5608:Utrn UTSW 10 12671837 missense probably benign 0.00
R5678:Utrn UTSW 10 12442018 missense probably damaging 1.00
R5726:Utrn UTSW 10 12669806 missense probably benign
R5804:Utrn UTSW 10 12421625 missense probably damaging 1.00
R5916:Utrn UTSW 10 12665051 missense probably damaging 0.97
R5941:Utrn UTSW 10 12486483 missense probably damaging 1.00
R6014:Utrn UTSW 10 12690876 missense probably benign 0.01
R6015:Utrn UTSW 10 12478424 missense possibly damaging 0.85
R6028:Utrn UTSW 10 12654716 missense probably benign 0.00
R6158:Utrn UTSW 10 12690822 missense probably benign 0.04
R6181:Utrn UTSW 10 12739456 missense probably damaging 1.00
R6300:Utrn UTSW 10 12501476 missense probably benign 0.35
R6367:Utrn UTSW 10 12747975 missense probably damaging 1.00
R6377:Utrn UTSW 10 12744083 missense probably damaging 1.00
R6434:Utrn UTSW 10 12525427 missense probably damaging 1.00
R6498:Utrn UTSW 10 12442093 missense probably benign
R6579:Utrn UTSW 10 12748006 missense probably benign 0.05
R6704:Utrn UTSW 10 12745291 missense probably damaging 0.99
R6736:Utrn UTSW 10 12621303 missense probably benign 0.09
R6755:Utrn UTSW 10 12699087 missense probably benign 0.00
R6793:Utrn UTSW 10 12640925 critical splice donor site probably null
R6793:Utrn UTSW 10 12699100 missense possibly damaging 0.69
R6835:Utrn UTSW 10 12727764 missense probably damaging 1.00
R6919:Utrn UTSW 10 12693470 nonsense probably null
R6920:Utrn UTSW 10 12750470 missense probably damaging 0.98
R7037:Utrn UTSW 10 12826770 splice site probably null
R7038:Utrn UTSW 10 12682338 missense probably damaging 1.00
R7055:Utrn UTSW 10 12747921 missense probably benign 0.23
R7072:Utrn UTSW 10 12465213 missense probably damaging 1.00
R7090:Utrn UTSW 10 12684516 missense possibly damaging 0.58
R7211:Utrn UTSW 10 12401335 missense possibly damaging 0.72
R7248:Utrn UTSW 10 12728818 missense possibly damaging 0.51
R7305:Utrn UTSW 10 12385536 missense probably benign
R7334:Utrn UTSW 10 12728009 intron probably null
R7348:Utrn UTSW 10 12748018 missense probably damaging 1.00
R7375:Utrn UTSW 10 12641020 missense probably damaging 1.00
R7436:Utrn UTSW 10 12439791 missense possibly damaging 0.72
R7476:Utrn UTSW 10 12640951 missense probably benign
R7514:Utrn UTSW 10 12698089 missense probably benign 0.00
R7527:Utrn UTSW 10 12401382 missense possibly damaging 0.81
V1662:Utrn UTSW 10 12421640 missense probably damaging 1.00
X0018:Utrn UTSW 10 12735198 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- caccacacccagctAAGGAGGCTAA -3'
(R):5'- CAGAAGGGAAGCAAGACCTGGAAAGA -3'

Sequencing Primer
(F):5'- cacactcactcacaaacacac -3'
(R):5'- TGGAAAGAGCCTCACAGC -3'
Posted On2014-03-14