Incidental Mutation 'R1445:Mars'
ID158803
Institutional Source Beutler Lab
Gene Symbol Mars
Ensembl Gene ENSMUSG00000040354
Gene Namemethionine-tRNA synthetase
Synonymsmethionine tRNA ligase, MetRS, methionyl-tRNA synthetase
MMRRC Submission 039500-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R1445 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127296221-127311786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127297988 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 680 (D680G)
Ref Sequence ENSEMBL: ENSMUSP00000130666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026475] [ENSMUST00000037290] [ENSMUST00000139091] [ENSMUST00000171564] [ENSMUST00000230446]
Predicted Effect probably benign
Transcript: ENSMUST00000026475
SMART Domains Protein: ENSMUSP00000026475
Gene: ENSMUSG00000025408

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
BRLZ 94 160 1.23e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000037290
AA Change: D680G

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000037446
Gene: ENSMUSG00000040354
AA Change: D680G

DomainStartEndE-ValueType
PDB:4BL7|A 1 220 1e-118 PDB
low complexity region 221 233 N/A INTRINSIC
Pfam:tRNA-synt_1g 268 660 6.8e-142 PFAM
WHEP-TRS 847 902 7.95e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134686
Predicted Effect probably benign
Transcript: ENSMUST00000134778
SMART Domains Protein: ENSMUSP00000118031
Gene: ENSMUSG00000040354

DomainStartEndE-ValueType
SCOP:d1f4la1 5 91 2e-10 SMART
WHEP-TRS 129 184 7.95e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139091
SMART Domains Protein: ENSMUSP00000118339
Gene: ENSMUSG00000025408

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
BRLZ 94 160 1.23e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145275
Predicted Effect possibly damaging
Transcript: ENSMUST00000171564
AA Change: D680G

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130666
Gene: ENSMUSG00000040354
AA Change: D680G

DomainStartEndE-ValueType
low complexity region 17 26 N/A INTRINSIC
Pfam:GST_C 94 180 1e-6 PFAM
low complexity region 205 213 N/A INTRINSIC
low complexity region 221 233 N/A INTRINSIC
Pfam:tRNA-synt_1g 268 660 9.6e-149 PFAM
WHEP-TRS 855 910 7.95e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230446
Meta Mutation Damage Score 0.1581 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.9%
  • 20x: 84.0%
Validation Efficiency 96% (101/105)
MGI Phenotype FUNCTION: The encoded protein belongs to the class I family of tRNA synthetases, a class of enzymes that charge tRNAs with their cognate amino acids. The related human gene product is essential for the translation initiation of mRNAs. This gene has an overlapping 3' UTR tail-to-tail arrangement with an adjacent gene on the opposite strand that encodes an inhibitor of the CCAAT/enhancer-binding protein's DNA binding activity. This arrangement, conserved in human and mouse, may be involved in mRNA stability and possible functional and regulatory interaction of these adjacent overlapping genes. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061I17Rik G T 3: 117,067,736 noncoding transcript Het
2300003K06Rik G T 11: 99,837,967 Q17K probably benign Het
Abca16 T C 7: 120,520,033 V999A probably benign Het
Actn3 C T 19: 4,865,455 probably benign Het
Agap2 T A 10: 127,091,112 probably benign Het
Ago3 C A 4: 126,371,787 R278L probably benign Het
Aldh1a2 T C 9: 71,285,210 V449A possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aplnr A G 2: 85,137,009 Y126C probably damaging Het
Apob T C 12: 8,016,084 I4351T possibly damaging Het
Ash1l T C 3: 89,007,352 L1763P probably benign Het
Aspn T C 13: 49,557,373 S165P possibly damaging Het
Atg13 A T 2: 91,679,990 V349E probably damaging Het
Atp1b2 T A 11: 69,602,483 probably null Het
B3glct A T 5: 149,754,139 D411V probably damaging Het
Bcar3 A T 3: 122,523,191 I255F probably damaging Het
Cacna1b G A 2: 24,718,136 probably benign Het
Cep164 T G 9: 45,778,900 E675A possibly damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Chst8 C A 7: 34,748,168 M8I possibly damaging Het
Clec4n A G 6: 123,235,516 E67G probably benign Het
Cobll1 A T 2: 65,099,136 D653E probably damaging Het
Col9a1 T C 1: 24,237,498 probably null Het
Crip2 T C 12: 113,143,504 L30P probably damaging Het
Ctbp1 C T 5: 33,261,063 V22I probably benign Het
Cwc22 T C 2: 77,917,177 probably benign Het
Cyp4a32 C A 4: 115,602,950 Y119* probably null Het
Dido1 G T 2: 180,671,470 A463E possibly damaging Het
Dnah7a G A 1: 53,528,797 P1880L probably benign Het
Dock2 T A 11: 34,239,705 T1489S probably benign Het
Dsp A G 13: 38,191,931 T1231A probably damaging Het
Eif2ak1 G T 5: 143,873,899 probably benign Het
Epc1 A T 18: 6,452,360 M233K probably damaging Het
Fam189a2 G A 19: 24,021,634 T140M probably damaging Het
Gigyf2 A G 1: 87,443,638 probably benign Het
Greb1 T G 12: 16,707,851 H58P probably damaging Het
Gtpbp1 T C 15: 79,713,448 I348T possibly damaging Het
Hck A T 2: 153,128,272 N64Y probably benign Het
Herc2 T C 7: 56,168,996 S2812P probably damaging Het
Inpp4b T A 8: 81,952,834 probably null Het
Kcnq5 A C 1: 21,405,024 S473A probably benign Het
Lrat T G 3: 82,903,369 D115A probably damaging Het
Lyst A G 13: 13,640,054 I1131M possibly damaging Het
Man2a2 T C 7: 80,368,562 D160G probably benign Het
Marf1 C T 16: 14,115,824 D1567N probably benign Het
Mat1a T C 14: 41,121,840 S339P probably damaging Het
Megf8 T C 7: 25,342,656 S1300P probably damaging Het
Mga T C 2: 119,902,698 L9S probably damaging Het
Mllt6 T C 11: 97,672,451 probably benign Het
Mrpl37 A G 4: 107,064,495 L179P probably benign Het
Mtnr1a G T 8: 45,087,745 V248L probably benign Het
Mylk T C 16: 34,815,465 S19P possibly damaging Het
Olfr738 A G 14: 50,414,401 T286A probably damaging Het
Parp8 A T 13: 117,025,350 probably null Het
Pcnx2 T C 8: 125,752,284 D2075G probably damaging Het
Pigo A T 4: 43,021,460 I494K probably benign Het
Pkd1l1 A T 11: 8,870,313 D1217E probably benign Het
Pkhd1l1 T C 15: 44,505,644 V895A probably benign Het
Plcb4 A T 2: 136,000,189 H1031L possibly damaging Het
Plxnb1 A G 9: 109,108,921 K1245R probably null Het
Pold1 C T 7: 44,542,757 probably benign Het
Ptprq T C 10: 107,662,562 I885V probably damaging Het
Ptprz1 A G 6: 23,050,474 D1398G probably damaging Het
Pygm G A 19: 6,389,887 A364T probably benign Het
Rbl1 T C 2: 157,193,098 N354S probably benign Het
Scgb2b19 C T 7: 33,279,612 probably null Het
Slc26a8 C T 17: 28,648,213 V545M possibly damaging Het
Slc27a1 T A 8: 71,584,113 probably null Het
Smpd1 A G 7: 105,556,674 D416G possibly damaging Het
Sorbs3 A G 14: 70,193,646 V284A probably benign Het
Stfa2l1 T C 16: 36,161,784 V75A probably damaging Het
Syndig1 A G 2: 149,930,921 D166G probably damaging Het
Tcp10a G A 17: 7,326,007 probably null Het
Themis2 T A 4: 132,782,901 I663F possibly damaging Het
Thrap3 T C 4: 126,176,336 Q586R probably damaging Het
Tinag C A 9: 77,045,516 C62F probably damaging Het
Tmem206 A G 1: 191,348,362 probably benign Het
Tmod1 T C 4: 46,090,884 Y146H probably damaging Het
Tmprss4 T A 9: 45,184,385 I54F possibly damaging Het
Tnks A C 8: 34,834,603 probably benign Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Trpc6 A G 9: 8,680,537 E844G probably benign Het
Ubtd2 C T 11: 32,516,125 R115W probably damaging Het
Ubxn6 T C 17: 56,069,042 D373G probably benign Het
Upf1 T A 8: 70,341,524 Q244L probably benign Het
Usp33 A G 3: 152,368,634 I372M probably damaging Het
Usp34 A G 11: 23,351,629 E351G probably damaging Het
Utrn A G 10: 12,678,574 probably benign Het
Vmn1r78 A G 7: 12,152,581 K40E possibly damaging Het
Vmn2r7 T A 3: 64,724,802 M80L probably benign Het
Vps13a G T 19: 16,701,238 Y1126* probably null Het
Wfdc11 T C 2: 164,664,446 N60S probably benign Het
Wnk2 C T 13: 49,071,110 D992N probably damaging Het
Zpbp2 C A 11: 98,553,844 T66K probably damaging Het
Other mutations in Mars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Mars APN 10 127298006 missense probably benign 0.31
IGL00813:Mars APN 10 127300047 missense probably damaging 1.00
IGL01292:Mars APN 10 127305518 missense probably damaging 1.00
IGL01718:Mars APN 10 127305838 missense possibly damaging 0.95
IGL02505:Mars APN 10 127304244 nonsense probably null
IGL02986:Mars APN 10 127297569 missense probably benign 0.09
PIT4366001:Mars UTSW 10 127299398 missense possibly damaging 0.72
R0149:Mars UTSW 10 127300034 missense probably damaging 1.00
R1702:Mars UTSW 10 127310079 missense possibly damaging 0.52
R1998:Mars UTSW 10 127300478 nonsense probably null
R1998:Mars UTSW 10 127302871 missense probably benign
R2089:Mars UTSW 10 127299285 missense probably damaging 1.00
R2091:Mars UTSW 10 127299285 missense probably damaging 1.00
R2091:Mars UTSW 10 127299285 missense probably damaging 1.00
R4597:Mars UTSW 10 127300453 missense probably damaging 1.00
R4809:Mars UTSW 10 127300215 missense probably damaging 1.00
R4923:Mars UTSW 10 127296680 unclassified probably benign
R5563:Mars UTSW 10 127308661 missense probably benign
R5890:Mars UTSW 10 127298045 missense probably benign 0.04
R5895:Mars UTSW 10 127296549 missense probably benign 0.01
R5986:Mars UTSW 10 127304302 nonsense probably null
R6300:Mars UTSW 10 127296560 missense probably benign 0.00
R7267:Mars UTSW 10 127308586 missense probably benign
R7544:Mars UTSW 10 127311610 missense probably benign 0.24
R7573:Mars UTSW 10 127302810 critical splice donor site probably null
R7740:Mars UTSW 10 127300575 missense probably benign 0.16
X0027:Mars UTSW 10 127308349 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGCAAGGCAGCCATGTTCAC -3'
(R):5'- CCAGGAATTGTCAGGCTTATGCAGG -3'

Sequencing Primer
(F):5'- CAGGGCTCATTCACTTGAATGTATTG -3'
(R):5'- caccacggagatgccag -3'
Posted On2014-03-14