Incidental Mutation 'R1446:Kat14'
ID 158847
Institutional Source Beutler Lab
Gene Symbol Kat14
Ensembl Gene ENSMUSG00000027425
Gene Name lysine acetyltransferase 14
Synonyms D2Wsu131e, 2510008M08Rik, ATAC2, Csrp2bp, D2Ertd473e
MMRRC Submission 039501-MU
Accession Numbers

Genbank: NM_181417; MGI: 1917264

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1446 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 144368983-144407676 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 144373718 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 41 (E41G)
Ref Sequence ENSEMBL: ENSMUSP00000028911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028911] [ENSMUST00000147747] [ENSMUST00000183618]
AlphaFold Q8CID0
Predicted Effect probably damaging
Transcript: ENSMUST00000028911
AA Change: E41G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028911
Gene: ENSMUSG00000027425
AA Change: E41G

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
low complexity region 310 334 N/A INTRINSIC
Pfam:Acetyltransf_10 640 748 7e-12 PFAM
Pfam:Acetyltransf_7 670 750 5.8e-12 PFAM
Pfam:Acetyltransf_1 675 749 7.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131836
Predicted Effect probably benign
Transcript: ENSMUST00000147747
SMART Domains Protein: ENSMUSP00000130785
Gene: ENSMUSG00000027425

DomainStartEndE-ValueType
low complexity region 99 123 N/A INTRINSIC
Pfam:Acetyltransf_10 428 537 6.3e-12 PFAM
Pfam:Acetyltransf_7 458 539 5.7e-12 PFAM
Pfam:Acetyltransf_1 464 538 3.1e-12 PFAM
Pfam:FR47 479 544 2.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171261
Predicted Effect probably benign
Transcript: ENSMUST00000183618
SMART Domains Protein: ENSMUSP00000139043
Gene: ENSMUSG00000098387

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 27 36 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CSRP2 is a protein containing two LIM domains, which are double zinc finger motifs found in proteins of diverse function. CSRP2 and some related proteins are thought to act as protein adapters, bridging two or more proteins to form a larger protein complex. The protein encoded by this gene binds to one of the LIM domains of CSRP2 and contains an acetyltransferase domain. Although the encoded protein has been detected in the cytoplasm, it is predominantly a nuclear protein. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, decreased size, increased apoptosis, and disrupted cell cycling. Mice heterozygous for one targeted allele exhibit corneal opacity. [provided by MGI curators]
Allele List at MGI

All alleles(54) : Targeted, other(1) Gene trapped(53)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C T 5: 76,886,289 A472T probably benign Het
Adcy4 A T 14: 55,770,023 probably null Het
Ahcyl2 T C 6: 29,891,240 S448P probably damaging Het
Anks1b A G 10: 90,511,073 Y745C probably benign Het
Anxa1 A T 19: 20,373,739 L339Q probably damaging Het
Apoa4 A G 9: 46,242,293 D64G probably benign Het
Arpc1a A G 5: 145,101,086 probably null Het
Bank1 C T 3: 136,064,143 G727R probably damaging Het
Best2 T C 8: 85,007,964 Q375R probably benign Het
Cacna1b T A 2: 24,706,177 M501L probably benign Het
Col27a1 T A 4: 63,224,803 Y243N probably damaging Het
Cyp11a1 A T 9: 58,015,277 Q80L possibly damaging Het
Dnah10 T A 5: 124,789,796 W2260R probably damaging Het
Dnajc19 T C 3: 34,057,979 H139R probably benign Het
Dppa5a T A 9: 78,367,789 N77I probably benign Het
Edc4 T C 8: 105,888,132 S125P probably damaging Het
Eid2 T C 7: 28,268,589 I212T possibly damaging Het
Fam234b T A 6: 135,209,330 probably null Het
Frem2 T C 3: 53,654,596 E830G probably benign Het
Fyb A T 15: 6,652,466 I765L probably benign Het
Fyn T G 10: 39,522,779 S124A probably benign Het
Gal3st3 T A 19: 5,306,911 F105I probably damaging Het
Gm13762 A G 2: 88,973,765 I42T probably benign Het
Gpr146 A G 5: 139,393,422 I326M probably benign Het
Grk2 G A 19: 4,287,409 R617C possibly damaging Het
Gsn A G 2: 35,306,586 K669R probably benign Het
H2-T10 A T 17: 36,119,374 I225N possibly damaging Het
Il12rb2 T C 6: 67,309,143 H106R probably benign Het
Kcnma1 G T 14: 23,311,724 T1006K probably damaging Het
Kif18b G A 11: 102,914,699 T244I probably damaging Het
Klb A T 5: 65,348,995 H195L probably damaging Het
Lrriq4 T C 3: 30,650,578 F252L probably benign Het
Lum C T 10: 97,568,390 T49I possibly damaging Het
Map3k4 T A 17: 12,256,794 L84* probably null Het
Mindy2 A G 9: 70,607,456 probably null Het
Mpped2 G T 2: 106,783,732 R137L possibly damaging Het
Myo18b G A 5: 112,757,559 R2058W probably damaging Het
Nol8 T A 13: 49,655,227 L65Q probably damaging Het
Olfr1009 A G 2: 85,721,573 H56R probably damaging Het
Olfr1269 A T 2: 90,118,858 L247M probably damaging Het
Olfr1458 G A 19: 13,103,016 A96V possibly damaging Het
Olfr147 T G 9: 38,403,305 C144G possibly damaging Het
Olfr460 C T 6: 40,571,899 S171L probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Parp12 G T 6: 39,102,561 D338E probably benign Het
Pde6d T C 1: 86,546,692 E77G probably damaging Het
Phkg1 A C 5: 129,873,214 probably null Het
Pigw A C 11: 84,878,360 S48A probably benign Het
Pkm T A 9: 59,668,910 probably null Het
Ppp1r3f G A X: 7,560,363 T553M probably damaging Het
Retreg2 T A 1: 75,143,459 F44L possibly damaging Het
Ryr2 A T 13: 11,738,149 M1762K probably benign Het
Sec16a A G 2: 26,423,567 V1927A probably benign Het
Sec23a G T 12: 58,978,559 A492E probably damaging Het
Skint4 T A 4: 112,118,114 H82Q probably benign Het
Srbd1 T C 17: 86,139,152 K60E probably benign Het
Stk24 A G 14: 121,308,044 Y101H probably damaging Het
Sult1e1 A T 5: 87,578,537 N239K probably damaging Het
Tgs1 C T 4: 3,604,848 P757S probably damaging Het
Tmc2 A T 2: 130,248,730 E665D probably damaging Het
Tmprss15 C A 16: 79,078,958 D163Y probably benign Het
Unc13a C A 8: 71,648,981 V1009L possibly damaging Het
Unc45b G T 11: 82,928,670 G490C probably damaging Het
Vmn1r177 T A 7: 23,866,340 H37L probably damaging Het
Vwa5a A G 9: 38,733,968 M450V possibly damaging Het
Wars2 T C 3: 99,187,527 I46T probably benign Het
Wdfy3 G T 5: 101,851,310 T3098K possibly damaging Het
Zan A T 5: 137,389,360 I4863N unknown Het
Zfp616 A G 11: 74,083,238 probably null Het
Zfp770 A T 2: 114,197,033 I185N probably damaging Het
Zfp808 T G 13: 62,173,007 H683Q probably damaging Het
Zmym4 A T 4: 126,882,482 W1221R probably damaging Het
Other mutations in Kat14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Kat14 APN 2 144394255 missense probably benign 0.01
IGL01361:Kat14 APN 2 144406620 splice site probably null
IGL01958:Kat14 APN 2 144394365 missense probably damaging 1.00
IGL02499:Kat14 APN 2 144393831 missense probably benign 0.45
IGL02625:Kat14 APN 2 144402445 missense possibly damaging 0.79
IGL02814:Kat14 APN 2 144402463 missense probably benign
IGL02883:Kat14 APN 2 144393529 missense probably damaging 1.00
IGL03114:Kat14 APN 2 144375965 critical splice donor site probably null
A5278:Kat14 UTSW 2 144393307 nonsense probably null
R1517:Kat14 UTSW 2 144373791 missense probably benign 0.00
R1589:Kat14 UTSW 2 144394100 missense probably benign 0.06
R2071:Kat14 UTSW 2 144389216 missense probably damaging 1.00
R3911:Kat14 UTSW 2 144404062 missense probably damaging 1.00
R3951:Kat14 UTSW 2 144407329 utr 3 prime probably benign
R4167:Kat14 UTSW 2 144394110 missense probably damaging 1.00
R4624:Kat14 UTSW 2 144404220 intron probably benign
R4628:Kat14 UTSW 2 144404220 intron probably benign
R4629:Kat14 UTSW 2 144404220 intron probably benign
R4944:Kat14 UTSW 2 144375953 missense probably damaging 0.99
R5401:Kat14 UTSW 2 144389260 missense possibly damaging 0.77
R5429:Kat14 UTSW 2 144393323 missense probably benign 0.03
R7165:Kat14 UTSW 2 144393998 missense probably benign 0.03
R7453:Kat14 UTSW 2 144380734 missense possibly damaging 0.85
R7738:Kat14 UTSW 2 144394242 missense probably damaging 1.00
R9130:Kat14 UTSW 2 144373822 missense probably benign 0.30
R9260:Kat14 UTSW 2 144393521 missense probably benign 0.02
X0018:Kat14 UTSW 2 144373857 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATACCTGACTTTCAGAAGCCGGGG -3'
(R):5'- TTTCAGAGACTGGAAAGAAGCCATCAC -3'

Sequencing Primer
(F):5'- TTAGTGAGAAGAGCTGCCCC -3'
(R):5'- GAAGCCATCACATGAGGACC -3'
Posted On 2014-03-14