Incidental Mutation 'R1446:Zmym4'
ID158856
Institutional Source Beutler Lab
Gene Symbol Zmym4
Ensembl Gene ENSMUSG00000042446
Gene Namezinc finger, MYM-type 4
SynonymsZfp262, 6330503C17Rik
MMRRC Submission 039501-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.758) question?
Stock #R1446 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location126861939-126968135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126882482 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 1221 (W1221R)
Ref Sequence ENSEMBL: ENSMUSP00000101714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106108]
Predicted Effect probably damaging
Transcript: ENSMUST00000106108
AA Change: W1221R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101714
Gene: ENSMUSG00000042446
AA Change: W1221R

DomainStartEndE-ValueType
TRASH 341 377 6.53e-4 SMART
TRASH 389 429 7.22e-6 SMART
TRASH 441 479 1.77e0 SMART
TRASH 486 525 4.95e-4 SMART
TRASH 531 569 1.05e-2 SMART
TRASH 579 615 2.82e1 SMART
low complexity region 640 649 N/A INTRINSIC
TRASH 687 723 8.49e-3 SMART
TRASH 729 764 1.14e-3 SMART
TRASH 772 810 4.48e-2 SMART
TRASH 816 851 2.06e-1 SMART
low complexity region 974 993 N/A INTRINSIC
low complexity region 1002 1021 N/A INTRINSIC
Pfam:DUF3504 1357 1527 1.7e-68 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000135003
AA Change: W880R
SMART Domains Protein: ENSMUSP00000120813
Gene: ENSMUSG00000042446
AA Change: W880R

DomainStartEndE-ValueType
TRASH 90 126 6.53e-4 SMART
TRASH 138 178 7.22e-6 SMART
TRASH 190 228 1.77e0 SMART
TRASH 235 274 3.05e-4 SMART
low complexity region 300 309 N/A INTRINSIC
TRASH 347 383 8.49e-3 SMART
TRASH 389 424 1.14e-3 SMART
TRASH 432 470 4.48e-2 SMART
TRASH 476 511 2.06e-1 SMART
low complexity region 634 653 N/A INTRINSIC
low complexity region 662 681 N/A INTRINSIC
Pfam:DUF3504 1017 1187 1.5e-68 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C T 5: 76,886,289 A472T probably benign Het
Adcy4 A T 14: 55,770,023 probably null Het
Ahcyl2 T C 6: 29,891,240 S448P probably damaging Het
Anks1b A G 10: 90,511,073 Y745C probably benign Het
Anxa1 A T 19: 20,373,739 L339Q probably damaging Het
Apoa4 A G 9: 46,242,293 D64G probably benign Het
Arpc1a A G 5: 145,101,086 probably null Het
Bank1 C T 3: 136,064,143 G727R probably damaging Het
Best2 T C 8: 85,007,964 Q375R probably benign Het
Cacna1b T A 2: 24,706,177 M501L probably benign Het
Col27a1 T A 4: 63,224,803 Y243N probably damaging Het
Cyp11a1 A T 9: 58,015,277 Q80L possibly damaging Het
Dnah10 T A 5: 124,789,796 W2260R probably damaging Het
Dnajc19 T C 3: 34,057,979 H139R probably benign Het
Dppa5a T A 9: 78,367,789 N77I probably benign Het
Edc4 T C 8: 105,888,132 S125P probably damaging Het
Eid2 T C 7: 28,268,589 I212T possibly damaging Het
Fam234b T A 6: 135,209,330 probably null Het
Frem2 T C 3: 53,654,596 E830G probably benign Het
Fyb A T 15: 6,652,466 I765L probably benign Het
Fyn T G 10: 39,522,779 S124A probably benign Het
Gal3st3 T A 19: 5,306,911 F105I probably damaging Het
Gm13762 A G 2: 88,973,765 I42T probably benign Het
Gpr146 A G 5: 139,393,422 I326M probably benign Het
Grk2 G A 19: 4,287,409 R617C possibly damaging Het
Gsn A G 2: 35,306,586 K669R probably benign Het
H2-T10 A T 17: 36,119,374 I225N possibly damaging Het
Il12rb2 T C 6: 67,309,143 H106R probably benign Het
Kat14 A G 2: 144,373,718 E41G probably damaging Het
Kcnma1 G T 14: 23,311,724 T1006K probably damaging Het
Kif18b G A 11: 102,914,699 T244I probably damaging Het
Klb A T 5: 65,348,995 H195L probably damaging Het
Lrriq4 T C 3: 30,650,578 F252L probably benign Het
Lum C T 10: 97,568,390 T49I possibly damaging Het
Map3k4 T A 17: 12,256,794 L84* probably null Het
Mindy2 A G 9: 70,607,456 probably null Het
Mpped2 G T 2: 106,783,732 R137L possibly damaging Het
Myo18b G A 5: 112,757,559 R2058W probably damaging Het
Nol8 T A 13: 49,655,227 L65Q probably damaging Het
Olfr1009 A G 2: 85,721,573 H56R probably damaging Het
Olfr1269 A T 2: 90,118,858 L247M probably damaging Het
Olfr1458 G A 19: 13,103,016 A96V possibly damaging Het
Olfr147 T G 9: 38,403,305 C144G possibly damaging Het
Olfr460 C T 6: 40,571,899 S171L probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Parp12 G T 6: 39,102,561 D338E probably benign Het
Pde6d T C 1: 86,546,692 E77G probably damaging Het
Phkg1 A C 5: 129,873,214 probably null Het
Pigw A C 11: 84,878,360 S48A probably benign Het
Pkm T A 9: 59,668,910 probably null Het
Ppp1r3f G A X: 7,560,363 T553M probably damaging Het
Retreg2 T A 1: 75,143,459 F44L possibly damaging Het
Ryr2 A T 13: 11,738,149 M1762K probably benign Het
Sec16a A G 2: 26,423,567 V1927A probably benign Het
Sec23a G T 12: 58,978,559 A492E probably damaging Het
Skint4 T A 4: 112,118,114 H82Q probably benign Het
Srbd1 T C 17: 86,139,152 K60E probably benign Het
Stk24 A G 14: 121,308,044 Y101H probably damaging Het
Sult1e1 A T 5: 87,578,537 N239K probably damaging Het
Tgs1 C T 4: 3,604,848 P757S probably damaging Het
Tmc2 A T 2: 130,248,730 E665D probably damaging Het
Tmprss15 C A 16: 79,078,958 D163Y probably benign Het
Unc13a C A 8: 71,648,981 V1009L possibly damaging Het
Unc45b G T 11: 82,928,670 G490C probably damaging Het
Vmn1r177 T A 7: 23,866,340 H37L probably damaging Het
Vwa5a A G 9: 38,733,968 M450V possibly damaging Het
Wars2 T C 3: 99,187,527 I46T probably benign Het
Wdfy3 G T 5: 101,851,310 T3098K possibly damaging Het
Zan A T 5: 137,389,360 I4863N unknown Het
Zfp616 A G 11: 74,083,238 probably null Het
Zfp770 A T 2: 114,197,033 I185N probably damaging Het
Zfp808 T G 13: 62,173,007 H683Q probably damaging Het
Other mutations in Zmym4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Zmym4 APN 4 126890058 missense probably benign
IGL00845:Zmym4 APN 4 126900613 missense probably benign 0.28
IGL01122:Zmym4 APN 4 126864252 missense probably damaging 1.00
IGL01374:Zmym4 APN 4 126868957 missense probably damaging 1.00
IGL01564:Zmym4 APN 4 126911280 missense possibly damaging 0.84
IGL02014:Zmym4 APN 4 126900669 missense possibly damaging 0.67
IGL02187:Zmym4 APN 4 126870273 missense probably damaging 0.97
IGL02887:Zmym4 APN 4 126948475 missense probably damaging 0.96
IGL03371:Zmym4 APN 4 126915088 missense possibly damaging 0.90
IGL03400:Zmym4 APN 4 126923127 missense probably benign 0.12
foreclosed UTSW 4 126895306 missense probably damaging 1.00
foreshortened UTSW 4 126910936 missense possibly damaging 0.75
R0149:Zmym4 UTSW 4 126911145 missense probably benign 0.00
R0361:Zmym4 UTSW 4 126911145 missense probably benign 0.00
R0423:Zmym4 UTSW 4 126882319 splice site probably benign
R0532:Zmym4 UTSW 4 126898401 nonsense probably null
R0745:Zmym4 UTSW 4 126902703 splice site probably benign
R1183:Zmym4 UTSW 4 126925839 missense probably damaging 0.99
R1401:Zmym4 UTSW 4 126911169 missense probably benign 0.00
R1491:Zmym4 UTSW 4 126882312 critical splice acceptor site probably null
R1566:Zmym4 UTSW 4 126911147 missense possibly damaging 0.94
R1962:Zmym4 UTSW 4 126902670 missense possibly damaging 0.47
R2398:Zmym4 UTSW 4 126923136 missense probably damaging 1.00
R2930:Zmym4 UTSW 4 126925523 missense probably benign 0.00
R3891:Zmym4 UTSW 4 126904476 missense probably benign 0.04
R3892:Zmym4 UTSW 4 126904476 missense probably benign 0.04
R4659:Zmym4 UTSW 4 126948428 splice site probably null
R4702:Zmym4 UTSW 4 126923165 missense probably benign 0.01
R5160:Zmym4 UTSW 4 126870184 missense probably damaging 0.97
R5614:Zmym4 UTSW 4 126910936 missense possibly damaging 0.75
R5773:Zmym4 UTSW 4 126905370 missense possibly damaging 0.52
R6450:Zmym4 UTSW 4 126895306 missense probably damaging 1.00
R6741:Zmym4 UTSW 4 126915085 missense possibly damaging 0.80
R7023:Zmym4 UTSW 4 126868800 missense probably damaging 1.00
R7315:Zmym4 UTSW 4 126882592 missense probably benign 0.09
R7468:Zmym4 UTSW 4 126882236 missense probably benign 0.40
R7546:Zmym4 UTSW 4 126864168 missense probably damaging 0.99
R7609:Zmym4 UTSW 4 126925795 missense probably benign 0.02
R7764:Zmym4 UTSW 4 126925616 missense probably benign 0.06
R7897:Zmym4 UTSW 4 126889539 missense possibly damaging 0.76
R7980:Zmym4 UTSW 4 126889539 missense possibly damaging 0.76
U24488:Zmym4 UTSW 4 126925660 missense possibly damaging 0.69
Z1177:Zmym4 UTSW 4 126907212 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGTTCACCTCCTAACGAGACAGGTAA -3'
(R):5'- ACCATTTCAGCCCTGAATTCTGAATCTT -3'

Sequencing Primer
(F):5'- TCCTAACGAGACAGGTAAATAACAG -3'
(R):5'- TTCTTTTCATCTCTGAGAACTTAGAC -3'
Posted On2014-03-14