Incidental Mutation 'R1446:Olfr1458'
ID158915
Institutional Source Beutler Lab
Gene Symbol Olfr1458
Ensembl Gene ENSMUSG00000062844
Gene Nameolfactory receptor 1458
SynonymsEG667271, MOR202-24, GA_x6K02T2RE5P-3430689-3429787
MMRRC Submission 039501-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R1446 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13101593-13106775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13103016 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 96 (A96V)
Ref Sequence ENSEMBL: ENSMUSP00000149865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076729] [ENSMUST00000207340] [ENSMUST00000215160]
Predicted Effect probably benign
Transcript: ENSMUST00000076729
AA Change: A90V

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000076019
Gene: ENSMUSG00000062844
AA Change: A90V

DomainStartEndE-ValueType
Pfam:7tm_4 23 300 7.9e-51 PFAM
Pfam:7TM_GPCR_Srsx 27 297 1.2e-6 PFAM
Pfam:7tm_1 33 282 5.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207340
AA Change: A96V
Predicted Effect possibly damaging
Transcript: ENSMUST00000215160
AA Change: A96V

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C T 5: 76,886,289 A472T probably benign Het
Adcy4 A T 14: 55,770,023 probably null Het
Ahcyl2 T C 6: 29,891,240 S448P probably damaging Het
Anks1b A G 10: 90,511,073 Y745C probably benign Het
Anxa1 A T 19: 20,373,739 L339Q probably damaging Het
Apoa4 A G 9: 46,242,293 D64G probably benign Het
Arpc1a A G 5: 145,101,086 probably null Het
Bank1 C T 3: 136,064,143 G727R probably damaging Het
Best2 T C 8: 85,007,964 Q375R probably benign Het
Cacna1b T A 2: 24,706,177 M501L probably benign Het
Col27a1 T A 4: 63,224,803 Y243N probably damaging Het
Cyp11a1 A T 9: 58,015,277 Q80L possibly damaging Het
Dnah10 T A 5: 124,789,796 W2260R probably damaging Het
Dnajc19 T C 3: 34,057,979 H139R probably benign Het
Dppa5a T A 9: 78,367,789 N77I probably benign Het
Edc4 T C 8: 105,888,132 S125P probably damaging Het
Eid2 T C 7: 28,268,589 I212T possibly damaging Het
Fam234b T A 6: 135,209,330 probably null Het
Frem2 T C 3: 53,654,596 E830G probably benign Het
Fyb A T 15: 6,652,466 I765L probably benign Het
Fyn T G 10: 39,522,779 S124A probably benign Het
Gal3st3 T A 19: 5,306,911 F105I probably damaging Het
Gm13762 A G 2: 88,973,765 I42T probably benign Het
Gpr146 A G 5: 139,393,422 I326M probably benign Het
Grk2 G A 19: 4,287,409 R617C possibly damaging Het
Gsn A G 2: 35,306,586 K669R probably benign Het
H2-T10 A T 17: 36,119,374 I225N possibly damaging Het
Il12rb2 T C 6: 67,309,143 H106R probably benign Het
Kat14 A G 2: 144,373,718 E41G probably damaging Het
Kcnma1 G T 14: 23,311,724 T1006K probably damaging Het
Kif18b G A 11: 102,914,699 T244I probably damaging Het
Klb A T 5: 65,348,995 H195L probably damaging Het
Lrriq4 T C 3: 30,650,578 F252L probably benign Het
Lum C T 10: 97,568,390 T49I possibly damaging Het
Map3k4 T A 17: 12,256,794 L84* probably null Het
Mindy2 A G 9: 70,607,456 probably null Het
Mpped2 G T 2: 106,783,732 R137L possibly damaging Het
Myo18b G A 5: 112,757,559 R2058W probably damaging Het
Nol8 T A 13: 49,655,227 L65Q probably damaging Het
Olfr1009 A G 2: 85,721,573 H56R probably damaging Het
Olfr1269 A T 2: 90,118,858 L247M probably damaging Het
Olfr147 T G 9: 38,403,305 C144G possibly damaging Het
Olfr460 C T 6: 40,571,899 S171L probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Parp12 G T 6: 39,102,561 D338E probably benign Het
Pde6d T C 1: 86,546,692 E77G probably damaging Het
Phkg1 A C 5: 129,873,214 probably null Het
Pigw A C 11: 84,878,360 S48A probably benign Het
Pkm T A 9: 59,668,910 probably null Het
Ppp1r3f G A X: 7,560,363 T553M probably damaging Het
Retreg2 T A 1: 75,143,459 F44L possibly damaging Het
Ryr2 A T 13: 11,738,149 M1762K probably benign Het
Sec16a A G 2: 26,423,567 V1927A probably benign Het
Sec23a G T 12: 58,978,559 A492E probably damaging Het
Skint4 T A 4: 112,118,114 H82Q probably benign Het
Srbd1 T C 17: 86,139,152 K60E probably benign Het
Stk24 A G 14: 121,308,044 Y101H probably damaging Het
Sult1e1 A T 5: 87,578,537 N239K probably damaging Het
Tgs1 C T 4: 3,604,848 P757S probably damaging Het
Tmc2 A T 2: 130,248,730 E665D probably damaging Het
Tmprss15 C A 16: 79,078,958 D163Y probably benign Het
Unc13a C A 8: 71,648,981 V1009L possibly damaging Het
Unc45b G T 11: 82,928,670 G490C probably damaging Het
Vmn1r177 T A 7: 23,866,340 H37L probably damaging Het
Vwa5a A G 9: 38,733,968 M450V possibly damaging Het
Wars2 T C 3: 99,187,527 I46T probably benign Het
Wdfy3 G T 5: 101,851,310 T3098K possibly damaging Het
Zan A T 5: 137,389,360 I4863N unknown Het
Zfp616 A G 11: 74,083,238 probably null Het
Zfp770 A T 2: 114,197,033 I185N probably damaging Het
Zfp808 T G 13: 62,173,007 H683Q probably damaging Het
Zmym4 A T 4: 126,882,482 W1221R probably damaging Het
Other mutations in Olfr1458
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01684:Olfr1458 APN 19 13102989 missense possibly damaging 0.93
IGL02319:Olfr1458 APN 19 13102662 missense probably benign 0.14
IGL02926:Olfr1458 APN 19 13102823 missense possibly damaging 0.74
IGL03107:Olfr1458 APN 19 13103037 missense probably benign
IGL03304:Olfr1458 APN 19 13102741 missense probably damaging 1.00
R0046:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0049:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0099:Olfr1458 UTSW 19 13103140 missense probably benign 0.07
R0103:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0144:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0189:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0206:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0207:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0208:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0212:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0344:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0426:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0506:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0507:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0607:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0661:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0734:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R1347:Olfr1458 UTSW 19 13102690 missense probably benign 0.03
R1347:Olfr1458 UTSW 19 13102690 missense probably benign 0.03
R1443:Olfr1458 UTSW 19 13103204 nonsense probably null
R1567:Olfr1458 UTSW 19 13102642 missense probably benign 0.00
R2190:Olfr1458 UTSW 19 13102493 missense probably damaging 1.00
R2438:Olfr1458 UTSW 19 13102421 missense probably benign 0.00
R4020:Olfr1458 UTSW 19 13102426 missense probably damaging 0.99
R4406:Olfr1458 UTSW 19 13102594 missense possibly damaging 0.70
R4631:Olfr1458 UTSW 19 13103272 missense probably benign 0.07
R4847:Olfr1458 UTSW 19 13102534 missense probably damaging 1.00
R4979:Olfr1458 UTSW 19 13102689 missense probably damaging 0.97
R6086:Olfr1458 UTSW 19 13102381 makesense probably null
R6480:Olfr1458 UTSW 19 13102474 missense probably benign 0.34
R6484:Olfr1458 UTSW 19 13103067 missense probably benign 0.34
R6786:Olfr1458 UTSW 19 13103203 missense probably benign 0.09
R7121:Olfr1458 UTSW 19 13103173 missense probably benign 0.03
R7547:Olfr1458 UTSW 19 13103043 missense not run
R7822:Olfr1458 UTSW 19 13103053 missense probably benign 0.00
X0024:Olfr1458 UTSW 19 13103209 missense probably benign 0.22
X0027:Olfr1458 UTSW 19 13103224 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GCAATCATGACTGCTGGAATGTCAC -3'
(R):5'- ACGCTTCATCCTGATGGGACTCAC -3'

Sequencing Primer
(F):5'- TGATGGACCACGTTTAACTCAC -3'
(R):5'- ATGGGACTCACCGATGATCC -3'
Posted On2014-03-14