Mutagenetix > Incidental Mutation

Incidental Mutation 'R1462:Adamts3'

158938

Institutional Source

Beutler Lab

Gene Symbol

Adamts3

Ensembl Gene

ENSMUSG00000043635

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3

Synonyms

6330442E02Rik, 1100001H14Rik

MMRRC Submission

039516-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1462 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

89677087-89883334 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 89861349 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 152 (I152V)

Ref Sequence

ENSEMBL: ENSMUSP00000142771 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159] [ENSMUST00000198151]

AlphaFold

E9Q287

Predicted Effect

probably benign
Transcript: ENSMUST00000061427
AA Change: I152V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: I152V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	42	201	5.1e-40	PFAM
Pfam:Reprolysin_5	254	439	5.4e-15	PFAM
Pfam:Reprolysin_4	256	454	1.9e-10	PFAM
Pfam:Reprolysin	257	460	3.6e-22	PFAM
Pfam:Reprolysin_2	274	451	7.7e-13	PFAM
Pfam:Reprolysin_3	278	409	1.5e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	827	3e-34	PFAM
TSP1	848	905	4.35e-2	SMART
TSP1	908	967	4.95e-2	SMART
TSP1	969	1016	6.58e-5	SMART
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1157	1177	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163159
AA Change: I152V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: I152V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	43	201	1.5e-40	PFAM
Pfam:Reprolysin_5	254	439	2.2e-15	PFAM
Pfam:Reprolysin_4	256	454	7.7e-11	PFAM
Pfam:Reprolysin	257	460	3.7e-21	PFAM
Pfam:Reprolysin_2	274	451	4.3e-14	PFAM
Pfam:Reprolysin_3	278	409	1.3e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	828	3.6e-28	PFAM
TSP1	849	906	4.35e-2	SMART
TSP1	909	968	4.95e-2	SMART
TSP1	970	1017	6.58e-5	SMART
low complexity region	1115	1129	N/A	INTRINSIC
low complexity region	1158	1178	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196507

Predicted Effect

probably benign
Transcript: ENSMUST00000198151
AA Change: I152V

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000142771
Gene: ENSMUSG00000043635
AA Change: I152V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	42	174	2.3e-29	PFAM

Meta Mutation Damage Score

0.0888

Coding Region Coverage

1x: 98.7%
3x: 97.4%
10x: 92.6%
20x: 79.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	C	A	7: 40,992,946	S104*	probably null	Het
Abca9	T	C	11: 110,160,516	D118G	probably benign	Het
Adamts16	A	G	13: 70,836,134	F137L	probably benign	Het
Adcy4	T	A	14: 55,778,308	E441D	possibly damaging	Het
Adgra1	T	A	7: 139,875,829	Y458N	probably damaging	Het
Bhlhe22	C	G	3: 18,055,782	S332C	probably damaging	Het
Card19	T	A	13: 49,205,284	Q71L	probably benign	Het
Ccdc12	T	C	9: 110,656,594	L11P	probably damaging	Het
Ccdc129	A	G	6: 55,975,664	H864R	probably damaging	Het
Cdadc1	A	G	14: 59,575,858	Y367H	probably damaging	Het
Cdc5l	G	T	17: 45,408,362	Q542K	possibly damaging	Het
Cep170	T	C	1: 176,756,645	K723E	possibly damaging	Het
Cep70	A	G	9: 99,263,720	I147V	probably benign	Het
Cfap58	A	T	19: 47,962,430	H410L	probably damaging	Het
Chat	T	C	14: 32,420,778	K418R	probably damaging	Het
Cic	T	G	7: 25,271,607	D254E	probably damaging	Het
Ckap4	T	C	10: 84,527,567	E544G	probably damaging	Het
Crnkl1	C	T	2: 145,921,819	A500T	probably damaging	Het
Cyp2c38	T	C	19: 39,392,188	N418D	probably damaging	Het
Daam1	A	T	12: 71,944,142	I177L	unknown	Het
Ercc5	A	G	1: 44,180,624	T1019A	probably damaging	Het
F13b	T	A	1: 139,507,636	V173E	probably damaging	Het
Fam20a	A	C	11: 109,677,317	F316V	probably damaging	Het
Flrt2	T	C	12: 95,779,338	V150A	probably damaging	Het
Fnta	A	C	8: 25,999,571		probably null	Het
Ghsr	A	G	3: 27,371,876	D27G	probably benign	Het
Gm21671	T	A	5: 25,951,625	I119F	possibly damaging	Het
Gtpbp1	A	G	15: 79,707,885	N96D	probably damaging	Het
H1fnt	A	T	15: 98,256,573	W232R	unknown	Het
Ibtk	A	T	9: 85,724,145	I443N	probably damaging	Het
Ifi207	T	C	1: 173,724,947	H968R	probably damaging	Het
Ifit2	A	G	19: 34,573,186	D42G	probably null	Het
Il17rc	A	T	6: 113,478,989	D265V	probably damaging	Het
Itfg2	T	C	6: 128,424,728	D29G	probably damaging	Het
Lrrc1	A	G	9: 77,442,265	F295L	probably benign	Het
Mrps28	T	A	3: 8,900,124	H85L	possibly damaging	Het
Mtpn	T	A	6: 35,522,758	K37M	possibly damaging	Het
Mug1	C	T	6: 121,882,629	H1196Y	probably benign	Het
Mup4	T	C	4: 59,960,084	H60R	possibly damaging	Het
Mybl2	T	C	2: 163,072,708	S249P	probably benign	Het
Naip6	A	G	13: 100,300,240	Y592H	possibly damaging	Het
Nrp1	A	G	8: 128,502,798	N919S	probably benign	Het
Nudt9	C	T	5: 104,065,038	Q326*	probably null	Het
Olfr1136	A	T	2: 87,693,376	C169S	probably damaging	Het
Olfr813	A	G	10: 129,857,231	T238A	probably damaging	Het
Olfr827	T	A	10: 130,210,723	I136F	probably benign	Het
Olfr829	T	A	9: 18,857,111	M162K	probably benign	Het
Pcsk4	T	C	10: 80,325,981	E142G	probably damaging	Het
Pde3a	C	A	6: 141,459,834	P471T	probably benign	Het
Pign	A	T	1: 105,585,002	V652E	possibly damaging	Het
Prkcb	T	A	7: 122,582,449	M420K	probably damaging	Het
Prr14	T	A	7: 127,473,988		probably null	Het
Rchy1	T	A	5: 91,957,882	Q69L	probably damaging	Het
Sec23ip	T	G	7: 128,766,138	S625A	probably benign	Het
Smpdl3b	A	G	4: 132,746,614	S47P	probably damaging	Het
Stil	G	A	4: 115,023,964	M568I	probably benign	Het
Syt3	T	A	7: 44,396,010	V558E	probably damaging	Het
Szt2	A	G	4: 118,373,967	V2533A	unknown	Het
Tenm4	A	G	7: 96,704,153	Y384C	probably damaging	Het
Tfam	T	C	10: 71,235,550	E94G	probably damaging	Het
Tmbim7	A	G	5: 3,664,304	T14A	probably damaging	Het
Tmtc2	A	T	10: 105,573,705	Y15*	probably null	Het
Uhrf1	C	T	17: 56,318,035	A526V	probably damaging	Het
Vmn2r67	T	C	7: 85,155,838	D22G	probably benign	Het
Vmn2r96	A	G	17: 18,597,398	I412M	possibly damaging	Het
Wdr17	A	T	8: 54,670,328	I479K	probably damaging	Het
Wt1	T	C	2: 105,166,831	V371A	probably damaging	Het
Zfp536	G	T	7: 37,479,310	S226Y	probably damaging	Het
Zfp827	T	C	8: 79,076,479	V560A	probably benign	Het

Other mutations in Adamts3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Adamts3	APN	5	89861325	missense	probably damaging	1.00
IGL00340:Adamts3	APN	5	89701666	missense	probably damaging	1.00
IGL00923:Adamts3	APN	5	89684376	missense	probably benign	0.06
IGL01420:Adamts3	APN	5	89703057	missense	possibly damaging	0.57
IGL01522:Adamts3	APN	5	89702943	missense	probably benign	0.14
IGL01676:Adamts3	APN	5	89677754	missense	probably benign	0.00
IGL01676:Adamts3	APN	5	89881543	missense	possibly damaging	0.54
IGL01678:Adamts3	APN	5	89707856	missense	probably damaging	1.00
IGL01936:Adamts3	APN	5	89861423	missense	probably benign	0.00
IGL01956:Adamts3	APN	5	89677911	missense	probably damaging	0.99
IGL02342:Adamts3	APN	5	89691473	splice site	probably null
IGL02415:Adamts3	APN	5	89706647	splice site	probably null
IGL03261:Adamts3	APN	5	89882897	utr 5 prime	probably benign
IGL03301:Adamts3	APN	5	89707404	missense	probably damaging	1.00
R0041:Adamts3	UTSW	5	89684467	missense	probably benign
R0079:Adamts3	UTSW	5	89693053	missense	probably benign	0.00
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0477:Adamts3	UTSW	5	89684507	missense	probably benign
R0605:Adamts3	UTSW	5	89861475	missense	possibly damaging	0.96
R1036:Adamts3	UTSW	5	89696093	splice site	probably benign
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1621:Adamts3	UTSW	5	89721701	missense	probably damaging	1.00
R1799:Adamts3	UTSW	5	89775421	missense	probably benign	0.00
R2163:Adamts3	UTSW	5	89708718	missense	probably damaging	0.99
R2412:Adamts3	UTSW	5	89701771	missense	probably damaging	0.99
R2420:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2421:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2422:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2921:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2922:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2923:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R3402:Adamts3	UTSW	5	89701733	missense	probably benign	0.04
R3431:Adamts3	UTSW	5	89707453	splice site	probably benign
R3432:Adamts3	UTSW	5	89707453	splice site	probably benign
R3813:Adamts3	UTSW	5	89677926	missense	possibly damaging	0.67
R3816:Adamts3	UTSW	5	89705264	missense	probably damaging	0.99
R3905:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3906:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3907:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3908:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R4557:Adamts3	UTSW	5	89700487	missense	probably benign	0.03
R4684:Adamts3	UTSW	5	89703007	missense	probably damaging	0.98
R4844:Adamts3	UTSW	5	89677816	missense	probably damaging	0.99
R4925:Adamts3	UTSW	5	89684323	missense	probably benign	0.01
R5097:Adamts3	UTSW	5	89693050	missense	probably damaging	0.97
R5100:Adamts3	UTSW	5	89708643	missense	probably damaging	1.00
R5237:Adamts3	UTSW	5	89775377	missense	probably benign
R5265:Adamts3	UTSW	5	89861552	missense	possibly damaging	0.91
R5322:Adamts3	UTSW	5	89707300	splice site	probably null
R5413:Adamts3	UTSW	5	89708767	missense	probably damaging	1.00
R5459:Adamts3	UTSW	5	89691473	splice site	probably null
R5738:Adamts3	UTSW	5	89708668	missense	probably damaging	1.00
R5979:Adamts3	UTSW	5	89861669	missense	probably damaging	0.96
R5992:Adamts3	UTSW	5	89691335	missense	probably damaging	1.00
R6364:Adamts3	UTSW	5	89721814	missense	possibly damaging	0.92
R6572:Adamts3	UTSW	5	89861609	missense	possibly damaging	0.87
R7098:Adamts3	UTSW	5	89861495	missense	probably damaging	1.00
R7172:Adamts3	UTSW	5	89883001	start gained	probably benign
R7263:Adamts3	UTSW	5	89677742	missense	probably benign	0.03
R7401:Adamts3	UTSW	5	89707450	critical splice acceptor site	probably null
R7599:Adamts3	UTSW	5	89861397	missense	probably benign	0.00
R7829:Adamts3	UTSW	5	89861490	missense	probably damaging	1.00
R7835:Adamts3	UTSW	5	89700440	missense	possibly damaging	0.70
R7892:Adamts3	UTSW	5	89861429	missense	probably benign	0.10
R8021:Adamts3	UTSW	5	89683184	missense	possibly damaging	0.47
R8289:Adamts3	UTSW	5	89775423	missense	possibly damaging	0.89
R8350:Adamts3	UTSW	5	89702956	missense	probably damaging	1.00
R8468:Adamts3	UTSW	5	89694768	missense	probably benign	0.19
R8827:Adamts3	UTSW	5	89691465	missense	probably benign	0.03
R8864:Adamts3	UTSW	5	89707122	intron	probably benign
R8906:Adamts3	UTSW	5	89677716	missense	probably damaging	0.98
R9000:Adamts3	UTSW	5	89706711	missense	probably benign	0.17
R9005:Adamts3	UTSW	5	89677834	missense	probably benign	0.08
R9378:Adamts3	UTSW	5	89700410	nonsense	probably null
R9505:Adamts3	UTSW	5	89707892	missense	probably damaging	1.00
R9516:Adamts3	UTSW	5	89686891	missense	probably damaging	1.00
X0064:Adamts3	UTSW	5	89703042	missense	possibly damaging	0.75
Z1088:Adamts3	UTSW	5	89684449	missense	probably damaging	0.99
Z1176:Adamts3	UTSW	5	89775351	missense	not run
Z1177:Adamts3	UTSW	5	89707864	nonsense	probably null
Z1177:Adamts3	UTSW	5	89775351	missense	not run

Predicted Primers

PCR Primer
(F):5'- TAGAGCAGAGGAGTCCTGCCAAAC -3'
(R):5'- TCAACGTCACGGCATTTGGAAGAG -3'

Sequencing Primer
(F):5'- AAACCCACTATGCTGCCTATAGTTG -3'
(R):5'- GAGATTTTCATCTTCGACTGAAGCC -3'

Posted On

2014-03-14