Incidental Mutation 'R1448:Cxcr2'
ID158999
Institutional Source Beutler Lab
Gene Symbol Cxcr2
Ensembl Gene ENSMUSG00000026180
Gene Namechemokine (C-X-C motif) receptor 2
SynonymsCD128, IL-8rb, Cmkar2, IL8RA, Il8rb, IL-8Rh, Gpcr16
MMRRC Submission 039503-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1448 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location74153989-74161246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74158368 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 7 (D7V)
Ref Sequence ENSEMBL: ENSMUSP00000102512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027372] [ENSMUST00000106899]
Predicted Effect probably benign
Transcript: ENSMUST00000027372
AA Change: D7V

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000027372
Gene: ENSMUSG00000026180
AA Change: D7V

DomainStartEndE-ValueType
Pfam:7tm_1 64 313 1.2e-53 PFAM
low complexity region 346 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106899
AA Change: D7V

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102512
Gene: ENSMUSG00000026180
AA Change: D7V

DomainStartEndE-ValueType
Pfam:7tm_1 64 313 1.1e-58 PFAM
low complexity region 346 358 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein-coupled receptor family. This protein is a receptor for interleukin 8 (IL8). It binds to IL8 with high affinity, and transduces the signal through a G-protein activated second messenger system. This receptor also binds to chemokine (C-X-C motif) ligand 1 (CXCL1/MGSA), a protein with melanoma growth stimulating activity, and has been shown to be a major component required for serum-dependent melanoma cell growth. This receptor mediates neutrophil migration to sites of inflammation. The angiogenic effects of IL8 in intestinal microvascular endothelial cells are found to be mediated by this receptor. Knockout studies in mice suggested that this receptor controls the positioning of oligodendrocyte precursors in developing spinal cord by arresting their migration. This gene, IL8RA, a gene encoding another high affinity IL8 receptor, as well as IL8RBP, a pseudogene of IL8RB, form a gene cluster in a region mapped to chromosome 2q33-q36. Alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile but exhibit splenomegaly, lymphadenopathy, and increased susceptibility to various pathogens due to impaired neutrophil recruitment and decreased pathogen clearance during innate immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417H12Rik T A 7: 107,624,745 probably benign Het
A1cf A T 19: 31,908,796 N35I possibly damaging Het
Abca2 T C 2: 25,440,530 I1106T possibly damaging Het
Abca4 G A 3: 122,162,928 probably null Het
Adgrv1 T C 13: 81,433,513 D4804G probably benign Het
Adk T A 14: 21,052,640 M1K probably null Het
Aff3 T C 1: 38,191,283 N1006D probably damaging Het
Akap12 A G 10: 4,355,475 T762A probably benign Het
Atp12a T A 14: 56,385,839 M843K probably damaging Het
Bbx T A 16: 50,266,270 K169* probably null Het
Bicra A T 7: 15,988,359 V411E possibly damaging Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Cel T C 2: 28,556,326 Y511C probably damaging Het
Celf4 G T 18: 25,503,083 probably null Het
Clasp1 A G 1: 118,508,916 N310S probably benign Het
Col6a3 T C 1: 90,781,855 K1873R unknown Het
Cstf1 A G 2: 172,375,875 D136G probably damaging Het
Cwc22 T A 2: 77,911,555 E470D probably damaging Het
Cytip A G 2: 58,145,180 I168T probably damaging Het
D5Ertd579e A G 5: 36,602,739 L1359P probably benign Het
Ddx25 A C 9: 35,557,738 V26G probably benign Het
Dennd4a T A 9: 64,906,045 S1429T possibly damaging Het
Dmd A G X: 84,848,700 D2990G probably damaging Het
Dopey1 C A 9: 86,542,732 probably null Het
Eps8 T C 6: 137,522,854 Q209R possibly damaging Het
Fabp6 T A 11: 43,596,165 I112F probably benign Het
Fam159b T C 13: 104,845,962 I151V probably benign Het
Fam214a C G 9: 75,010,174 S685* probably null Het
Fbxw10 T C 11: 62,847,592 V104A possibly damaging Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Grin3a T C 4: 49,702,804 Y894C probably damaging Het
Hydin C T 8: 110,446,585 H967Y probably benign Het
Ip6k3 T C 17: 27,145,268 K269E possibly damaging Het
Jup T C 11: 100,383,200 K172E probably damaging Het
Katnal1 T C 5: 148,904,676 D126G probably benign Het
Knl1 A T 2: 119,068,307 K163M probably damaging Het
Krt17 C T 11: 100,257,539 E359K possibly damaging Het
Lct T A 1: 128,307,822 I483F probably damaging Het
Loxl2 G A 14: 69,693,040 G751D probably damaging Het
Ltbp4 G A 7: 27,306,577 R1559C possibly damaging Het
Man2c1 T A 9: 57,135,219 D183E probably benign Het
Med17 T C 9: 15,275,843 probably null Het
Mrgpra9 A C 7: 47,235,813 S34R probably benign Het
Mrpl44 T A 1: 79,777,960 N94K probably damaging Het
Nat8f1 A G 6: 85,910,942 V12A probably benign Het
Nr2e3 C A 9: 59,943,514 G354V probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup155 T C 15: 8,112,406 V94A probably benign Het
Olfr1497 A T 19: 13,794,776 Y278* probably null Het
Olfr294 A T 7: 86,616,361 C95S probably damaging Het
Olfr502 T C 7: 108,523,318 I211V probably benign Het
Olfr649 C T 7: 104,189,875 V111I possibly damaging Het
Pcdhb10 A T 18: 37,412,503 I211F possibly damaging Het
Phip A C 9: 82,915,423 I509S possibly damaging Het
Pkhd1 C T 1: 20,585,157 probably null Het
Psme4 T G 11: 30,852,744 L1487R probably damaging Het
Ptgdr2 A G 19: 10,940,493 S125G probably damaging Het
Ptpro A G 6: 137,441,116 K126E probably damaging Het
Rdh16f2 T A 10: 127,876,925 V264E probably benign Het
Ric8b C T 10: 84,947,671 A131V possibly damaging Het
Rock1 A T 18: 10,070,233 I1280N probably damaging Het
Rprd2 A G 3: 95,818,576 V59A possibly damaging Het
Ruvbl1 T A 6: 88,467,569 C49S probably benign Het
Scn2a A G 2: 65,683,845 N291S probably benign Het
Serbp1 T A 6: 67,277,920 H325Q probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slitrk3 G A 3: 73,050,341 T366I probably damaging Het
Spryd3 A T 15: 102,118,392 H307Q possibly damaging Het
Spx A T 6: 142,418,513 D100V probably benign Het
Surf4 A G 2: 26,924,464 F142L probably damaging Het
Syne2 T A 12: 76,020,325 probably null Het
Syne2 T C 12: 76,052,178 M5278T possibly damaging Het
Thap12 T C 7: 98,716,023 V466A probably benign Het
Thap3 T C 4: 151,983,216 K135R possibly damaging Het
Tmem131 G T 1: 36,827,358 D448E probably benign Het
Tmem63b C G 17: 45,678,978 R88P possibly damaging Het
Trim43a G T 9: 88,582,093 C19F probably damaging Het
Trp63 C T 16: 25,889,120 P526L possibly damaging Het
Ubqln3 T C 7: 104,142,790 D31G probably damaging Het
Utp14b C A 1: 78,665,445 N353K probably damaging Het
Vmn1r40 A G 6: 89,714,576 K125R probably damaging Het
Vmn2r1 A G 3: 64,101,313 Y471C probably damaging Het
Vmn2r13 A G 5: 109,174,135 I232T probably damaging Het
Zfp263 A C 16: 3,746,459 E204D probably benign Het
Zfp865 A T 7: 5,029,279 K88* probably null Het
Other mutations in Cxcr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02128:Cxcr2 APN 1 74158994 missense probably benign 0.07
IGL03384:Cxcr2 APN 1 74158791 missense probably damaging 0.98
copperas UTSW 1 74158460 missense probably damaging 0.98
R0780:Cxcr2 UTSW 1 74159175 missense probably damaging 0.97
R1178:Cxcr2 UTSW 1 74158368 missense probably benign 0.04
R1180:Cxcr2 UTSW 1 74158368 missense probably benign 0.04
R1535:Cxcr2 UTSW 1 74159058 missense probably damaging 1.00
R1851:Cxcr2 UTSW 1 74159279 missense probably benign 0.01
R1852:Cxcr2 UTSW 1 74159279 missense probably benign 0.01
R2897:Cxcr2 UTSW 1 74158971 missense probably benign 0.04
R2898:Cxcr2 UTSW 1 74158971 missense probably benign 0.04
R4430:Cxcr2 UTSW 1 74158845 missense probably benign 0.01
R4542:Cxcr2 UTSW 1 74158529 missense probably benign 0.02
R5625:Cxcr2 UTSW 1 74158832 nonsense probably null
R5996:Cxcr2 UTSW 1 74158460 missense probably damaging 0.98
R6737:Cxcr2 UTSW 1 74158631 missense probably benign
R7206:Cxcr2 UTSW 1 74159054 missense possibly damaging 0.69
R7577:Cxcr2 UTSW 1 74158915 missense probably benign 0.00
R7717:Cxcr2 UTSW 1 74158839 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGTTTGAGCCCAACCAAGTCCC -3'
(R):5'- GAGCAGGTGCTCCGGTTGTATAAG -3'

Sequencing Primer
(F):5'- AGTTTTTATGCCCCACAAATATCTC -3'
(R):5'- CTCCGGTTGTATAAGATGACCAG -3'
Posted On2014-03-14