Incidental Mutation 'R1448:Cel'
ID159008
Institutional Source Beutler Lab
Gene Symbol Cel
Ensembl Gene ENSMUSG00000026818
Gene Namecarboxyl ester lipase
Synonyms1810036E18Rik, BAL
MMRRC Submission 039503-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R1448 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location28555795-28563403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28556326 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 511 (Y511C)
Ref Sequence ENSEMBL: ENSMUSP00000028161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028161] [ENSMUST00000028170] [ENSMUST00000100241] [ENSMUST00000113893] [ENSMUST00000140704]
Predicted Effect probably damaging
Transcript: ENSMUST00000028161
AA Change: Y511C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028161
Gene: ENSMUSG00000026818
AA Change: Y511C

DomainStartEndE-ValueType
Pfam:COesterase 1 542 2.4e-163 PFAM
Pfam:Abhydrolase_3 121 226 8e-8 PFAM
low complexity region 568 589 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028170
SMART Domains Protein: ENSMUSP00000028170
Gene: ENSMUSG00000026821

DomainStartEndE-ValueType
RasGEFN 56 194 4.02e-37 SMART
low complexity region 239 285 N/A INTRINSIC
RasGEF 320 587 5.28e-118 SMART
low complexity region 613 626 N/A INTRINSIC
low complexity region 646 655 N/A INTRINSIC
low complexity region 683 712 N/A INTRINSIC
low complexity region 716 726 N/A INTRINSIC
RA 736 823 6.51e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100241
SMART Domains Protein: ENSMUSP00000097812
Gene: ENSMUSG00000026821

DomainStartEndE-ValueType
RasGEFN 111 249 4.02e-37 SMART
low complexity region 294 340 N/A INTRINSIC
RasGEF 375 642 5.28e-118 SMART
low complexity region 668 681 N/A INTRINSIC
low complexity region 701 710 N/A INTRINSIC
low complexity region 738 767 N/A INTRINSIC
low complexity region 771 781 N/A INTRINSIC
RA 791 878 6.51e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113893
SMART Domains Protein: ENSMUSP00000109526
Gene: ENSMUSG00000026821

DomainStartEndE-ValueType
RasGEFN 111 237 1.25e-42 SMART
low complexity region 282 328 N/A INTRINSIC
RasGEF 363 630 5.28e-118 SMART
low complexity region 656 669 N/A INTRINSIC
low complexity region 689 698 N/A INTRINSIC
low complexity region 726 755 N/A INTRINSIC
low complexity region 759 769 N/A INTRINSIC
RA 779 866 6.51e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137513
Predicted Effect probably benign
Transcript: ENSMUST00000140704
SMART Domains Protein: ENSMUSP00000118966
Gene: ENSMUSG00000026821

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
RA 36 123 6.51e-22 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein secreted from the pancreas into the digestive tract and from the lactating mammary gland into human milk. The physiological role of this protein is in cholesterol and lipid-soluble vitamin ester hydrolysis and absorption. This encoded protein promotes large chylomicron production in the intestine. Also its presence in plasma suggests its interactions with cholesterol and oxidized lipoproteins to modulate the progression of atherosclerosis. In pancreatic tumoral cells, this encoded protein is thought to be sequestrated within the Golgi compartment and is probably not secreted. This gene contains a variable number of tandem repeat (VNTR) polymorphism in the coding region that may influence the function of the encoded protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced cholesteryl ester absorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417H12Rik T A 7: 107,624,745 probably benign Het
A1cf A T 19: 31,908,796 N35I possibly damaging Het
Abca2 T C 2: 25,440,530 I1106T possibly damaging Het
Abca4 G A 3: 122,162,928 probably null Het
Adgrv1 T C 13: 81,433,513 D4804G probably benign Het
Adk T A 14: 21,052,640 M1K probably null Het
Aff3 T C 1: 38,191,283 N1006D probably damaging Het
Akap12 A G 10: 4,355,475 T762A probably benign Het
Atp12a T A 14: 56,385,839 M843K probably damaging Het
Bbx T A 16: 50,266,270 K169* probably null Het
Bicra A T 7: 15,988,359 V411E possibly damaging Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Celf4 G T 18: 25,503,083 probably null Het
Clasp1 A G 1: 118,508,916 N310S probably benign Het
Col6a3 T C 1: 90,781,855 K1873R unknown Het
Cstf1 A G 2: 172,375,875 D136G probably damaging Het
Cwc22 T A 2: 77,911,555 E470D probably damaging Het
Cxcr2 A T 1: 74,158,368 D7V probably benign Het
Cytip A G 2: 58,145,180 I168T probably damaging Het
D5Ertd579e A G 5: 36,602,739 L1359P probably benign Het
Ddx25 A C 9: 35,557,738 V26G probably benign Het
Dennd4a T A 9: 64,906,045 S1429T possibly damaging Het
Dmd A G X: 84,848,700 D2990G probably damaging Het
Dopey1 C A 9: 86,542,732 probably null Het
Eps8 T C 6: 137,522,854 Q209R possibly damaging Het
Fabp6 T A 11: 43,596,165 I112F probably benign Het
Fam159b T C 13: 104,845,962 I151V probably benign Het
Fam214a C G 9: 75,010,174 S685* probably null Het
Fbxw10 T C 11: 62,847,592 V104A possibly damaging Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Grin3a T C 4: 49,702,804 Y894C probably damaging Het
Hydin C T 8: 110,446,585 H967Y probably benign Het
Ip6k3 T C 17: 27,145,268 K269E possibly damaging Het
Jup T C 11: 100,383,200 K172E probably damaging Het
Katnal1 T C 5: 148,904,676 D126G probably benign Het
Knl1 A T 2: 119,068,307 K163M probably damaging Het
Krt17 C T 11: 100,257,539 E359K possibly damaging Het
Lct T A 1: 128,307,822 I483F probably damaging Het
Loxl2 G A 14: 69,693,040 G751D probably damaging Het
Ltbp4 G A 7: 27,306,577 R1559C possibly damaging Het
Man2c1 T A 9: 57,135,219 D183E probably benign Het
Med17 T C 9: 15,275,843 probably null Het
Mrgpra9 A C 7: 47,235,813 S34R probably benign Het
Mrpl44 T A 1: 79,777,960 N94K probably damaging Het
Nat8f1 A G 6: 85,910,942 V12A probably benign Het
Nr2e3 C A 9: 59,943,514 G354V probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup155 T C 15: 8,112,406 V94A probably benign Het
Olfr1497 A T 19: 13,794,776 Y278* probably null Het
Olfr294 A T 7: 86,616,361 C95S probably damaging Het
Olfr502 T C 7: 108,523,318 I211V probably benign Het
Olfr649 C T 7: 104,189,875 V111I possibly damaging Het
Pcdhb10 A T 18: 37,412,503 I211F possibly damaging Het
Phip A C 9: 82,915,423 I509S possibly damaging Het
Pkhd1 C T 1: 20,585,157 probably null Het
Psme4 T G 11: 30,852,744 L1487R probably damaging Het
Ptgdr2 A G 19: 10,940,493 S125G probably damaging Het
Ptpro A G 6: 137,441,116 K126E probably damaging Het
Rdh16f2 T A 10: 127,876,925 V264E probably benign Het
Ric8b C T 10: 84,947,671 A131V possibly damaging Het
Rock1 A T 18: 10,070,233 I1280N probably damaging Het
Rprd2 A G 3: 95,818,576 V59A possibly damaging Het
Ruvbl1 T A 6: 88,467,569 C49S probably benign Het
Scn2a A G 2: 65,683,845 N291S probably benign Het
Serbp1 T A 6: 67,277,920 H325Q probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slitrk3 G A 3: 73,050,341 T366I probably damaging Het
Spryd3 A T 15: 102,118,392 H307Q possibly damaging Het
Spx A T 6: 142,418,513 D100V probably benign Het
Surf4 A G 2: 26,924,464 F142L probably damaging Het
Syne2 T A 12: 76,020,325 probably null Het
Syne2 T C 12: 76,052,178 M5278T possibly damaging Het
Thap12 T C 7: 98,716,023 V466A probably benign Het
Thap3 T C 4: 151,983,216 K135R possibly damaging Het
Tmem131 G T 1: 36,827,358 D448E probably benign Het
Tmem63b C G 17: 45,678,978 R88P possibly damaging Het
Trim43a G T 9: 88,582,093 C19F probably damaging Het
Trp63 C T 16: 25,889,120 P526L possibly damaging Het
Ubqln3 T C 7: 104,142,790 D31G probably damaging Het
Utp14b C A 1: 78,665,445 N353K probably damaging Het
Vmn1r40 A G 6: 89,714,576 K125R probably damaging Het
Vmn2r1 A G 3: 64,101,313 Y471C probably damaging Het
Vmn2r13 A G 5: 109,174,135 I232T probably damaging Het
Zfp263 A C 16: 3,746,459 E204D probably benign Het
Zfp865 A T 7: 5,029,279 K88* probably null Het
Other mutations in Cel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Cel APN 2 28559385 missense probably damaging 0.98
IGL01327:Cel APN 2 28557955 missense possibly damaging 0.61
IGL01606:Cel APN 2 28560564 missense probably benign 0.04
R0304:Cel UTSW 2 28557771 missense probably benign 0.04
R0321:Cel UTSW 2 28561148 missense probably benign 0.00
R0865:Cel UTSW 2 28560615 missense probably damaging 1.00
R1123:Cel UTSW 2 28556740 missense probably damaging 1.00
R1424:Cel UTSW 2 28559624 missense probably damaging 0.99
R1597:Cel UTSW 2 28560467 splice site probably benign
R1717:Cel UTSW 2 28556777 missense probably damaging 1.00
R2256:Cel UTSW 2 28561192 missense probably damaging 1.00
R3149:Cel UTSW 2 28556131 missense probably benign 0.04
R4105:Cel UTSW 2 28558027 missense probably benign 0.35
R4520:Cel UTSW 2 28557968 missense probably benign 0.08
R5135:Cel UTSW 2 28559423 missense probably benign 0.39
R5318:Cel UTSW 2 28557708 missense possibly damaging 0.77
R5323:Cel UTSW 2 28560518 missense probably damaging 1.00
R5958:Cel UTSW 2 28560945 missense probably damaging 0.97
R6803:Cel UTSW 2 28558048 missense probably benign 0.36
R6976:Cel UTSW 2 28556842 missense probably damaging 1.00
R7342:Cel UTSW 2 28560637 nonsense probably null
R8496:Cel UTSW 2 28556188 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- ACTTTAGAAGCCAATGGTGGCAGG -3'
(R):5'- CACATGAGCAGGAGAACTGCTGAC -3'

Sequencing Primer
(F):5'- AACAACCTGGGAGTCGTCTG -3'
(R):5'- GAGAACTGCTGACCCAGCC -3'
Posted On2014-03-14