Incidental Mutation 'R1448:Scn2a'
ID159010
Institutional Source Beutler Lab
Gene Symbol Scn2a
Ensembl Gene ENSMUSG00000075318
Gene Namesodium channel, voltage-gated, type II, alpha
SynonymsA230052E19Rik, Scn2a1, Nav1.2
MMRRC Submission 039503-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1448 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location65620771-65767447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65683845 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 291 (N291S)
Ref Sequence ENSEMBL: ENSMUSP00000143882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000144254] [ENSMUST00000200829]
Predicted Effect probably benign
Transcript: ENSMUST00000028377
AA Change: N291S

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: N291S

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 2.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 9.6e-83 PFAM
Pfam:Ion_trans 759 994 3.6e-57 PFAM
Pfam:Na_trans_assoc 998 1204 1.7e-63 PFAM
Pfam:Ion_trans 1208 1484 3.3e-66 PFAM
Pfam:Ion_trans 1531 1788 2.8e-57 PFAM
Pfam:PKD_channel 1627 1782 8.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100067
AA Change: N291S

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: N291S

DomainStartEndE-ValueType
Pfam:Ion_trans 157 424 3.3e-75 PFAM
low complexity region 433 448 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
Pfam:DUF3451 488 711 2.6e-66 PFAM
Pfam:Ion_trans 794 983 1.1e-47 PFAM
Pfam:Na_trans_assoc 998 1219 3.5e-77 PFAM
Pfam:Ion_trans 1245 1473 4.4e-55 PFAM
PDB:1BYY|A 1475 1527 3e-31 PDB
Pfam:Ion_trans 1566 1776 2.4e-52 PFAM
Pfam:PKD_channel 1628 1783 3.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138368
Predicted Effect probably benign
Transcript: ENSMUST00000144254
AA Change: N291S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117955
Gene: ENSMUSG00000075318
AA Change: N291S

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 7.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
low complexity region 484 502 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200829
AA Change: N291S

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: N291S

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 1.2e-79 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 7.1e-80 PFAM
Pfam:Ion_trans 759 994 2.1e-55 PFAM
Pfam:Na_trans_assoc 998 1204 8e-61 PFAM
Pfam:Ion_trans 1208 1484 1.9e-64 PFAM
Pfam:Ion_trans 1531 1788 1.6e-55 PFAM
Pfam:PKD_channel 1627 1782 1.2e-4 PFAM
IQ 1905 1927 1.8e-5 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417H12Rik T A 7: 107,624,745 probably benign Het
A1cf A T 19: 31,908,796 N35I possibly damaging Het
Abca2 T C 2: 25,440,530 I1106T possibly damaging Het
Abca4 G A 3: 122,162,928 probably null Het
Adgrv1 T C 13: 81,433,513 D4804G probably benign Het
Adk T A 14: 21,052,640 M1K probably null Het
Aff3 T C 1: 38,191,283 N1006D probably damaging Het
Akap12 A G 10: 4,355,475 T762A probably benign Het
Atp12a T A 14: 56,385,839 M843K probably damaging Het
Bbx T A 16: 50,266,270 K169* probably null Het
Bicra A T 7: 15,988,359 V411E possibly damaging Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Cel T C 2: 28,556,326 Y511C probably damaging Het
Celf4 G T 18: 25,503,083 probably null Het
Clasp1 A G 1: 118,508,916 N310S probably benign Het
Col6a3 T C 1: 90,781,855 K1873R unknown Het
Cstf1 A G 2: 172,375,875 D136G probably damaging Het
Cwc22 T A 2: 77,911,555 E470D probably damaging Het
Cxcr2 A T 1: 74,158,368 D7V probably benign Het
Cytip A G 2: 58,145,180 I168T probably damaging Het
D5Ertd579e A G 5: 36,602,739 L1359P probably benign Het
Ddx25 A C 9: 35,557,738 V26G probably benign Het
Dennd4a T A 9: 64,906,045 S1429T possibly damaging Het
Dmd A G X: 84,848,700 D2990G probably damaging Het
Dopey1 C A 9: 86,542,732 probably null Het
Eps8 T C 6: 137,522,854 Q209R possibly damaging Het
Fabp6 T A 11: 43,596,165 I112F probably benign Het
Fam159b T C 13: 104,845,962 I151V probably benign Het
Fam214a C G 9: 75,010,174 S685* probably null Het
Fbxw10 T C 11: 62,847,592 V104A possibly damaging Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Grin3a T C 4: 49,702,804 Y894C probably damaging Het
Hydin C T 8: 110,446,585 H967Y probably benign Het
Ip6k3 T C 17: 27,145,268 K269E possibly damaging Het
Jup T C 11: 100,383,200 K172E probably damaging Het
Katnal1 T C 5: 148,904,676 D126G probably benign Het
Knl1 A T 2: 119,068,307 K163M probably damaging Het
Krt17 C T 11: 100,257,539 E359K possibly damaging Het
Lct T A 1: 128,307,822 I483F probably damaging Het
Loxl2 G A 14: 69,693,040 G751D probably damaging Het
Ltbp4 G A 7: 27,306,577 R1559C possibly damaging Het
Man2c1 T A 9: 57,135,219 D183E probably benign Het
Med17 T C 9: 15,275,843 probably null Het
Mrgpra9 A C 7: 47,235,813 S34R probably benign Het
Mrpl44 T A 1: 79,777,960 N94K probably damaging Het
Nat8f1 A G 6: 85,910,942 V12A probably benign Het
Nr2e3 C A 9: 59,943,514 G354V probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup155 T C 15: 8,112,406 V94A probably benign Het
Olfr1497 A T 19: 13,794,776 Y278* probably null Het
Olfr294 A T 7: 86,616,361 C95S probably damaging Het
Olfr502 T C 7: 108,523,318 I211V probably benign Het
Olfr649 C T 7: 104,189,875 V111I possibly damaging Het
Pcdhb10 A T 18: 37,412,503 I211F possibly damaging Het
Phip A C 9: 82,915,423 I509S possibly damaging Het
Pkhd1 C T 1: 20,585,157 probably null Het
Psme4 T G 11: 30,852,744 L1487R probably damaging Het
Ptgdr2 A G 19: 10,940,493 S125G probably damaging Het
Ptpro A G 6: 137,441,116 K126E probably damaging Het
Rdh16f2 T A 10: 127,876,925 V264E probably benign Het
Ric8b C T 10: 84,947,671 A131V possibly damaging Het
Rock1 A T 18: 10,070,233 I1280N probably damaging Het
Rprd2 A G 3: 95,818,576 V59A possibly damaging Het
Ruvbl1 T A 6: 88,467,569 C49S probably benign Het
Serbp1 T A 6: 67,277,920 H325Q probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slitrk3 G A 3: 73,050,341 T366I probably damaging Het
Spryd3 A T 15: 102,118,392 H307Q possibly damaging Het
Spx A T 6: 142,418,513 D100V probably benign Het
Surf4 A G 2: 26,924,464 F142L probably damaging Het
Syne2 T A 12: 76,020,325 probably null Het
Syne2 T C 12: 76,052,178 M5278T possibly damaging Het
Thap12 T C 7: 98,716,023 V466A probably benign Het
Thap3 T C 4: 151,983,216 K135R possibly damaging Het
Tmem131 G T 1: 36,827,358 D448E probably benign Het
Tmem63b C G 17: 45,678,978 R88P possibly damaging Het
Trim43a G T 9: 88,582,093 C19F probably damaging Het
Trp63 C T 16: 25,889,120 P526L possibly damaging Het
Ubqln3 T C 7: 104,142,790 D31G probably damaging Het
Utp14b C A 1: 78,665,445 N353K probably damaging Het
Vmn1r40 A G 6: 89,714,576 K125R probably damaging Het
Vmn2r1 A G 3: 64,101,313 Y471C probably damaging Het
Vmn2r13 A G 5: 109,174,135 I232T probably damaging Het
Zfp263 A C 16: 3,746,459 E204D probably benign Het
Zfp865 A T 7: 5,029,279 K88* probably null Het
Other mutations in Scn2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn2a APN 2 65764440 missense probably benign
IGL00159:Scn2a APN 2 65743090 missense probably damaging 1.00
IGL00418:Scn2a APN 2 65764522 missense probably benign 0.43
IGL00753:Scn2a APN 2 65683863 missense possibly damaging 0.66
IGL00770:Scn2a APN 2 65735853 missense probably damaging 1.00
IGL00774:Scn2a APN 2 65735853 missense probably damaging 1.00
IGL00847:Scn2a APN 2 65670734 missense probably damaging 1.00
IGL01155:Scn2a APN 2 65717748 missense probably damaging 1.00
IGL01329:Scn2a APN 2 65717508 missense probably benign 0.05
IGL01537:Scn2a APN 2 65715875 missense probably benign 0.00
IGL01672:Scn2a APN 2 65751934 missense probably damaging 1.00
IGL01958:Scn2a APN 2 65701829 missense probably damaging 1.00
IGL02028:Scn2a APN 2 65763658 missense probably damaging 0.96
IGL02142:Scn2a APN 2 65715838 missense probably damaging 1.00
IGL02160:Scn2a APN 2 65730116 missense probably damaging 1.00
IGL02183:Scn2a APN 2 65671603 missense probably benign 0.20
IGL02341:Scn2a APN 2 65688377 missense probably damaging 1.00
IGL02504:Scn2a APN 2 65683884 missense probably benign 0.02
IGL02530:Scn2a APN 2 65730178 missense probably damaging 0.99
IGL02621:Scn2a APN 2 65748879 splice site probably benign
IGL02652:Scn2a APN 2 65702038 missense possibly damaging 0.82
IGL02966:Scn2a APN 2 65701844 missense possibly damaging 0.93
IGL03188:Scn2a APN 2 65671653 missense probably damaging 0.99
IGL03329:Scn2a APN 2 65764629 missense probably benign
IGL03336:Scn2a APN 2 65688744 missense probably damaging 1.00
IGL03391:Scn2a APN 2 65764213 missense probably damaging 1.00
PIT4280001:Scn2a UTSW 2 65715730 missense probably damaging 1.00
PIT4362001:Scn2a UTSW 2 65683838 missense probably benign 0.09
PIT4403001:Scn2a UTSW 2 65711908 missense probably damaging 1.00
PIT4520001:Scn2a UTSW 2 65688419 missense probably damaging 1.00
R0021:Scn2a UTSW 2 65670515 missense possibly damaging 0.51
R0141:Scn2a UTSW 2 65711816 missense probably benign 0.01
R0240:Scn2a UTSW 2 65735774 missense probably benign 0.32
R0240:Scn2a UTSW 2 65735774 missense probably benign 0.32
R0335:Scn2a UTSW 2 65682091 missense probably damaging 1.00
R0508:Scn2a UTSW 2 65717842 missense probably damaging 0.99
R0558:Scn2a UTSW 2 65711925 missense probably benign 0.26
R0600:Scn2a UTSW 2 65701833 missense possibly damaging 0.90
R0667:Scn2a UTSW 2 65751996 missense possibly damaging 0.91
R1178:Scn2a UTSW 2 65686779 splice site probably benign
R1244:Scn2a UTSW 2 65763655 missense probably damaging 0.98
R1386:Scn2a UTSW 2 65688741 missense probably damaging 1.00
R1434:Scn2a UTSW 2 65701991 missense possibly damaging 0.79
R1440:Scn2a UTSW 2 65764594 missense probably benign
R1460:Scn2a UTSW 2 65701843 missense probably damaging 0.96
R1553:Scn2a UTSW 2 65713836 nonsense probably null
R1642:Scn2a UTSW 2 65683697 missense probably damaging 1.00
R1803:Scn2a UTSW 2 65670767 splice site probably null
R1981:Scn2a UTSW 2 65690170 missense probably damaging 1.00
R2002:Scn2a UTSW 2 65682083 missense probably null 1.00
R2068:Scn2a UTSW 2 65752073 missense probably benign 0.14
R2125:Scn2a UTSW 2 65752079 nonsense probably null
R2126:Scn2a UTSW 2 65752079 nonsense probably null
R2876:Scn2a UTSW 2 65715897 missense possibly damaging 0.64
R2878:Scn2a UTSW 2 65688371 missense probably damaging 1.00
R3113:Scn2a UTSW 2 65748785 missense possibly damaging 0.86
R3749:Scn2a UTSW 2 65713771 missense probably damaging 1.00
R3750:Scn2a UTSW 2 65713771 missense probably damaging 1.00
R3765:Scn2a UTSW 2 65682710 missense possibly damaging 0.51
R3850:Scn2a UTSW 2 65682031 missense probably benign 0.14
R4585:Scn2a UTSW 2 65743051 splice site probably null
R4586:Scn2a UTSW 2 65743051 splice site probably null
R4588:Scn2a UTSW 2 65713767 missense possibly damaging 0.76
R4622:Scn2a UTSW 2 65752027 missense probably benign 0.04
R5108:Scn2a UTSW 2 65688630 missense probably damaging 1.00
R5161:Scn2a UTSW 2 65764591 missense probably benign 0.00
R5235:Scn2a UTSW 2 65752011 missense probably damaging 1.00
R5464:Scn2a UTSW 2 65701756 missense probably damaging 1.00
R5586:Scn2a UTSW 2 65707295 nonsense probably null
R5630:Scn2a UTSW 2 65726365 missense probably damaging 1.00
R5715:Scn2a UTSW 2 65717584 missense probably benign 0.27
R5730:Scn2a UTSW 2 65682538 nonsense probably null
R5734:Scn2a UTSW 2 65717722 missense possibly damaging 0.49
R5779:Scn2a UTSW 2 65764483 missense probably benign 0.00
R6133:Scn2a UTSW 2 65743104 missense probably benign 0.35
R6547:Scn2a UTSW 2 65715897 missense probably benign 0.29
R6549:Scn2a UTSW 2 65764674 missense probably benign 0.05
R6818:Scn2a UTSW 2 65688669 nonsense probably null
R6999:Scn2a UTSW 2 65682109 missense probably benign
R7069:Scn2a UTSW 2 65764606 missense probably benign 0.00
R7073:Scn2a UTSW 2 65728443 missense probably benign 0.00
R7125:Scn2a UTSW 2 65763933 missense probably damaging 1.00
R7178:Scn2a UTSW 2 65748853 nonsense probably null
R7179:Scn2a UTSW 2 65701979 missense probably damaging 1.00
R7203:Scn2a UTSW 2 65748319 missense probably benign 0.01
R7227:Scn2a UTSW 2 65752023 missense probably damaging 0.98
R7269:Scn2a UTSW 2 65763769 missense probably damaging 1.00
R7358:Scn2a UTSW 2 65682506 nonsense probably null
R7388:Scn2a UTSW 2 65688654 missense probably damaging 1.00
R7491:Scn2a UTSW 2 65702008 missense probably damaging 0.99
R7619:Scn2a UTSW 2 65715903 missense probably damaging 1.00
R7695:Scn2a UTSW 2 65711907 missense probably damaging 0.99
R7735:Scn2a UTSW 2 65763669 missense probably benign 0.40
R7911:Scn2a UTSW 2 65682083 missense probably null 1.00
R8096:Scn2a UTSW 2 65764022 missense probably damaging 0.98
R8333:Scn2a UTSW 2 65683847 missense probably benign 0.01
R8416:Scn2a UTSW 2 65681001 missense probably benign 0.00
R8850:Scn2a UTSW 2 65688386 missense probably damaging 1.00
Z1176:Scn2a UTSW 2 65751868 missense possibly damaging 0.84
Z1177:Scn2a UTSW 2 65717735 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ATCCAGTCGGTGAAGAAGCTGTCTG -3'
(R):5'- AGATCATGCACGTTGAAATGGCTACTT -3'

Sequencing Primer
(F):5'- TTCATGGGCAACCTGAGGAA -3'
(R):5'- CACGTTGAAATGGCTACTTTCATC -3'
Posted On2014-03-14