Incidental Mutation 'R1448:Scn2a'
ID 159010
Institutional Source Beutler Lab
Gene Symbol Scn2a
Ensembl Gene ENSMUSG00000075318
Gene Name sodium channel, voltage-gated, type II, alpha
Synonyms A230052E19Rik, Nav1.2, Scn2a1
MMRRC Submission 039503-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1448 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 65451115-65597791 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 65514189 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 291 (N291S)
Ref Sequence ENSEMBL: ENSMUSP00000143882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000144254] [ENSMUST00000200829]
AlphaFold B1AWN6
Predicted Effect probably benign
Transcript: ENSMUST00000028377
AA Change: N291S

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: N291S

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 2.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 9.6e-83 PFAM
Pfam:Ion_trans 759 994 3.6e-57 PFAM
Pfam:Na_trans_assoc 998 1204 1.7e-63 PFAM
Pfam:Ion_trans 1208 1484 3.3e-66 PFAM
Pfam:Ion_trans 1531 1788 2.8e-57 PFAM
Pfam:PKD_channel 1627 1782 8.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100067
AA Change: N291S

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: N291S

DomainStartEndE-ValueType
Pfam:Ion_trans 157 424 3.3e-75 PFAM
low complexity region 433 448 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
Pfam:DUF3451 488 711 2.6e-66 PFAM
Pfam:Ion_trans 794 983 1.1e-47 PFAM
Pfam:Na_trans_assoc 998 1219 3.5e-77 PFAM
Pfam:Ion_trans 1245 1473 4.4e-55 PFAM
PDB:1BYY|A 1475 1527 3e-31 PDB
Pfam:Ion_trans 1566 1776 2.4e-52 PFAM
Pfam:PKD_channel 1628 1783 3.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138368
Predicted Effect probably benign
Transcript: ENSMUST00000144254
AA Change: N291S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117955
Gene: ENSMUSG00000075318
AA Change: N291S

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 7.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
low complexity region 484 502 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200829
AA Change: N291S

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: N291S

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 1.2e-79 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 7.1e-80 PFAM
Pfam:Ion_trans 759 994 2.1e-55 PFAM
Pfam:Na_trans_assoc 998 1204 8e-61 PFAM
Pfam:Ion_trans 1208 1484 1.9e-64 PFAM
Pfam:Ion_trans 1531 1788 1.6e-55 PFAM
Pfam:PKD_channel 1627 1782 1.2e-4 PFAM
IQ 1905 1927 1.8e-5 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417H12Rik T A 7: 107,223,952 (GRCm39) probably benign Het
A1cf A T 19: 31,886,196 (GRCm39) N35I possibly damaging Het
Abca2 T C 2: 25,330,542 (GRCm39) I1106T possibly damaging Het
Abca4 G A 3: 121,956,577 (GRCm39) probably null Het
Adgrv1 T C 13: 81,581,632 (GRCm39) D4804G probably benign Het
Adk T A 14: 21,102,708 (GRCm39) M1K probably null Het
Aff3 T C 1: 38,230,364 (GRCm39) N1006D probably damaging Het
Akap12 A G 10: 4,305,475 (GRCm39) T762A probably benign Het
Atosa C G 9: 74,917,456 (GRCm39) S685* probably null Het
Atp12a T A 14: 56,623,296 (GRCm39) M843K probably damaging Het
Bbx T A 16: 50,086,633 (GRCm39) K169* probably null Het
Bicra A T 7: 15,722,284 (GRCm39) V411E possibly damaging Het
Camk1d A T 2: 5,366,836 (GRCm39) Y126* probably null Het
Cel T C 2: 28,446,338 (GRCm39) Y511C probably damaging Het
Celf4 G T 18: 25,636,140 (GRCm39) probably null Het
Clasp1 A G 1: 118,436,646 (GRCm39) N310S probably benign Het
Col6a3 T C 1: 90,709,577 (GRCm39) K1873R unknown Het
Cstf1 A G 2: 172,217,795 (GRCm39) D136G probably damaging Het
Cwc22 T A 2: 77,741,899 (GRCm39) E470D probably damaging Het
Cxcr2 A T 1: 74,197,527 (GRCm39) D7V probably benign Het
Cytip A G 2: 58,035,192 (GRCm39) I168T probably damaging Het
D5Ertd579e A G 5: 36,760,083 (GRCm39) L1359P probably benign Het
Ddx25 A C 9: 35,469,034 (GRCm39) V26G probably benign Het
Dennd4a T A 9: 64,813,327 (GRCm39) S1429T possibly damaging Het
Dmd A G X: 83,892,306 (GRCm39) D2990G probably damaging Het
Dop1a C A 9: 86,424,785 (GRCm39) probably null Het
Eps8 T C 6: 137,499,852 (GRCm39) Q209R possibly damaging Het
Fabp6 T A 11: 43,486,992 (GRCm39) I112F probably benign Het
Fbxw10 T C 11: 62,738,418 (GRCm39) V104A possibly damaging Het
Gp1ba C T 11: 70,532,253 (GRCm39) P673L probably damaging Het
Grin3a T C 4: 49,702,804 (GRCm39) Y894C probably damaging Het
Hydin C T 8: 111,173,217 (GRCm39) H967Y probably benign Het
Ip6k3 T C 17: 27,364,242 (GRCm39) K269E possibly damaging Het
Jup T C 11: 100,274,026 (GRCm39) K172E probably damaging Het
Katnal1 T C 5: 148,841,486 (GRCm39) D126G probably benign Het
Knl1 A T 2: 118,898,788 (GRCm39) K163M probably damaging Het
Krt17 C T 11: 100,148,365 (GRCm39) E359K possibly damaging Het
Lct T A 1: 128,235,559 (GRCm39) I483F probably damaging Het
Loxl2 G A 14: 69,930,489 (GRCm39) G751D probably damaging Het
Ltbp4 G A 7: 27,006,002 (GRCm39) R1559C possibly damaging Het
Man2c1 T A 9: 57,042,503 (GRCm39) D183E probably benign Het
Med17 T C 9: 15,187,139 (GRCm39) probably null Het
Mrgpra9 A C 7: 46,885,561 (GRCm39) S34R probably benign Het
Mrpl44 T A 1: 79,755,677 (GRCm39) N94K probably damaging Het
Nat8f1 A G 6: 85,887,924 (GRCm39) V12A probably benign Het
Nr2e3 C A 9: 59,850,797 (GRCm39) G354V probably damaging Het
Nrbp1 T A 5: 31,403,157 (GRCm39) I210N probably damaging Het
Nup155 T C 15: 8,141,890 (GRCm39) V94A probably benign Het
Or14a256 A T 7: 86,265,569 (GRCm39) C95S probably damaging Het
Or52h2 C T 7: 103,839,082 (GRCm39) V111I possibly damaging Het
Or5p76 T C 7: 108,122,525 (GRCm39) I211V probably benign Het
Or9q2 A T 19: 13,772,140 (GRCm39) Y278* probably null Het
Pcdhb10 A T 18: 37,545,556 (GRCm39) I211F possibly damaging Het
Phip A C 9: 82,797,476 (GRCm39) I509S possibly damaging Het
Pkhd1 C T 1: 20,655,381 (GRCm39) probably null Het
Psme4 T G 11: 30,802,744 (GRCm39) L1487R probably damaging Het
Ptgdr2 A G 19: 10,917,857 (GRCm39) S125G probably damaging Het
Ptpro A G 6: 137,418,114 (GRCm39) K126E probably damaging Het
Rdh16f2 T A 10: 127,712,794 (GRCm39) V264E probably benign Het
Ric8b C T 10: 84,783,535 (GRCm39) A131V possibly damaging Het
Rock1 A T 18: 10,070,233 (GRCm39) I1280N probably damaging Het
Rprd2 A G 3: 95,725,888 (GRCm39) V59A possibly damaging Het
Ruvbl1 T A 6: 88,444,551 (GRCm39) C49S probably benign Het
Serbp1 T A 6: 67,254,904 (GRCm39) H325Q probably damaging Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Shisal2b T C 13: 104,982,470 (GRCm39) I151V probably benign Het
Slitrk3 G A 3: 72,957,674 (GRCm39) T366I probably damaging Het
Spryd3 A T 15: 102,026,827 (GRCm39) H307Q possibly damaging Het
Spx A T 6: 142,364,239 (GRCm39) D100V probably benign Het
Surf4 A G 2: 26,814,476 (GRCm39) F142L probably damaging Het
Syne2 T A 12: 76,067,099 (GRCm39) probably null Het
Syne2 T C 12: 76,098,952 (GRCm39) M5278T possibly damaging Het
Thap12 T C 7: 98,365,230 (GRCm39) V466A probably benign Het
Thap3 T C 4: 152,067,673 (GRCm39) K135R possibly damaging Het
Tmem131 G T 1: 36,866,439 (GRCm39) D448E probably benign Het
Tmem63b C G 17: 45,989,904 (GRCm39) R88P possibly damaging Het
Trim43a G T 9: 88,464,146 (GRCm39) C19F probably damaging Het
Trp63 C T 16: 25,707,870 (GRCm39) P526L possibly damaging Het
Ubqln3 T C 7: 103,791,997 (GRCm39) D31G probably damaging Het
Utp14b C A 1: 78,643,162 (GRCm39) N353K probably damaging Het
Vmn1r40 A G 6: 89,691,558 (GRCm39) K125R probably damaging Het
Vmn2r1 A G 3: 64,008,734 (GRCm39) Y471C probably damaging Het
Vmn2r13 A G 5: 109,322,001 (GRCm39) I232T probably damaging Het
Zfp263 A C 16: 3,564,323 (GRCm39) E204D probably benign Het
Zfp865 A T 7: 5,032,278 (GRCm39) K88* probably null Het
Other mutations in Scn2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn2a APN 2 65,594,784 (GRCm39) missense probably benign
IGL00159:Scn2a APN 2 65,573,434 (GRCm39) missense probably damaging 1.00
IGL00418:Scn2a APN 2 65,594,866 (GRCm39) missense probably benign 0.43
IGL00753:Scn2a APN 2 65,514,207 (GRCm39) missense possibly damaging 0.66
IGL00770:Scn2a APN 2 65,566,197 (GRCm39) missense probably damaging 1.00
IGL00774:Scn2a APN 2 65,566,197 (GRCm39) missense probably damaging 1.00
IGL00847:Scn2a APN 2 65,501,078 (GRCm39) missense probably damaging 1.00
IGL01155:Scn2a APN 2 65,548,092 (GRCm39) missense probably damaging 1.00
IGL01329:Scn2a APN 2 65,547,852 (GRCm39) missense probably benign 0.05
IGL01537:Scn2a APN 2 65,546,219 (GRCm39) missense probably benign 0.00
IGL01672:Scn2a APN 2 65,582,278 (GRCm39) missense probably damaging 1.00
IGL01958:Scn2a APN 2 65,532,173 (GRCm39) missense probably damaging 1.00
IGL02028:Scn2a APN 2 65,594,002 (GRCm39) missense probably damaging 0.96
IGL02142:Scn2a APN 2 65,546,182 (GRCm39) missense probably damaging 1.00
IGL02160:Scn2a APN 2 65,560,460 (GRCm39) missense probably damaging 1.00
IGL02183:Scn2a APN 2 65,501,947 (GRCm39) missense probably benign 0.20
IGL02341:Scn2a APN 2 65,518,721 (GRCm39) missense probably damaging 1.00
IGL02504:Scn2a APN 2 65,514,228 (GRCm39) missense probably benign 0.02
IGL02530:Scn2a APN 2 65,560,522 (GRCm39) missense probably damaging 0.99
IGL02621:Scn2a APN 2 65,579,223 (GRCm39) splice site probably benign
IGL02652:Scn2a APN 2 65,532,382 (GRCm39) missense possibly damaging 0.82
IGL02966:Scn2a APN 2 65,532,188 (GRCm39) missense possibly damaging 0.93
IGL03188:Scn2a APN 2 65,501,997 (GRCm39) missense probably damaging 0.99
IGL03329:Scn2a APN 2 65,594,973 (GRCm39) missense probably benign
IGL03336:Scn2a APN 2 65,519,088 (GRCm39) missense probably damaging 1.00
IGL03391:Scn2a APN 2 65,594,557 (GRCm39) missense probably damaging 1.00
PIT4280001:Scn2a UTSW 2 65,546,074 (GRCm39) missense probably damaging 1.00
PIT4362001:Scn2a UTSW 2 65,514,182 (GRCm39) missense probably benign 0.09
PIT4403001:Scn2a UTSW 2 65,542,252 (GRCm39) missense probably damaging 1.00
PIT4520001:Scn2a UTSW 2 65,518,763 (GRCm39) missense probably damaging 1.00
R0021:Scn2a UTSW 2 65,500,859 (GRCm39) missense possibly damaging 0.51
R0141:Scn2a UTSW 2 65,542,160 (GRCm39) missense probably benign 0.01
R0240:Scn2a UTSW 2 65,566,118 (GRCm39) missense probably benign 0.32
R0240:Scn2a UTSW 2 65,566,118 (GRCm39) missense probably benign 0.32
R0335:Scn2a UTSW 2 65,512,435 (GRCm39) missense probably damaging 1.00
R0508:Scn2a UTSW 2 65,548,186 (GRCm39) missense probably damaging 0.99
R0558:Scn2a UTSW 2 65,542,269 (GRCm39) missense probably benign 0.26
R0600:Scn2a UTSW 2 65,532,177 (GRCm39) missense possibly damaging 0.90
R0667:Scn2a UTSW 2 65,582,340 (GRCm39) missense possibly damaging 0.91
R1178:Scn2a UTSW 2 65,517,123 (GRCm39) splice site probably benign
R1244:Scn2a UTSW 2 65,593,999 (GRCm39) missense probably damaging 0.98
R1386:Scn2a UTSW 2 65,519,085 (GRCm39) missense probably damaging 1.00
R1434:Scn2a UTSW 2 65,532,335 (GRCm39) missense possibly damaging 0.79
R1440:Scn2a UTSW 2 65,594,938 (GRCm39) missense probably benign
R1460:Scn2a UTSW 2 65,532,187 (GRCm39) missense probably damaging 0.96
R1553:Scn2a UTSW 2 65,544,180 (GRCm39) nonsense probably null
R1642:Scn2a UTSW 2 65,514,041 (GRCm39) missense probably damaging 1.00
R1803:Scn2a UTSW 2 65,501,111 (GRCm39) splice site probably null
R1981:Scn2a UTSW 2 65,520,514 (GRCm39) missense probably damaging 1.00
R2002:Scn2a UTSW 2 65,512,427 (GRCm39) missense probably null 1.00
R2068:Scn2a UTSW 2 65,582,417 (GRCm39) missense probably benign 0.14
R2125:Scn2a UTSW 2 65,582,423 (GRCm39) nonsense probably null
R2126:Scn2a UTSW 2 65,582,423 (GRCm39) nonsense probably null
R2876:Scn2a UTSW 2 65,546,241 (GRCm39) missense possibly damaging 0.64
R2878:Scn2a UTSW 2 65,518,715 (GRCm39) missense probably damaging 1.00
R3113:Scn2a UTSW 2 65,579,129 (GRCm39) missense possibly damaging 0.86
R3749:Scn2a UTSW 2 65,544,115 (GRCm39) missense probably damaging 1.00
R3750:Scn2a UTSW 2 65,544,115 (GRCm39) missense probably damaging 1.00
R3765:Scn2a UTSW 2 65,513,054 (GRCm39) missense possibly damaging 0.51
R3850:Scn2a UTSW 2 65,512,375 (GRCm39) missense probably benign 0.14
R4585:Scn2a UTSW 2 65,573,395 (GRCm39) splice site probably null
R4586:Scn2a UTSW 2 65,573,395 (GRCm39) splice site probably null
R4588:Scn2a UTSW 2 65,544,111 (GRCm39) missense possibly damaging 0.76
R4622:Scn2a UTSW 2 65,582,371 (GRCm39) missense probably benign 0.04
R5108:Scn2a UTSW 2 65,518,974 (GRCm39) missense probably damaging 1.00
R5161:Scn2a UTSW 2 65,594,935 (GRCm39) missense probably benign 0.00
R5235:Scn2a UTSW 2 65,582,355 (GRCm39) missense probably damaging 1.00
R5464:Scn2a UTSW 2 65,532,100 (GRCm39) missense probably damaging 1.00
R5586:Scn2a UTSW 2 65,537,639 (GRCm39) nonsense probably null
R5630:Scn2a UTSW 2 65,556,709 (GRCm39) missense probably damaging 1.00
R5715:Scn2a UTSW 2 65,547,928 (GRCm39) missense probably benign 0.27
R5730:Scn2a UTSW 2 65,512,882 (GRCm39) nonsense probably null
R5734:Scn2a UTSW 2 65,548,066 (GRCm39) missense possibly damaging 0.49
R5779:Scn2a UTSW 2 65,594,827 (GRCm39) missense probably benign 0.00
R6133:Scn2a UTSW 2 65,573,448 (GRCm39) missense probably benign 0.35
R6547:Scn2a UTSW 2 65,546,241 (GRCm39) missense probably benign 0.29
R6549:Scn2a UTSW 2 65,595,018 (GRCm39) missense probably benign 0.05
R6818:Scn2a UTSW 2 65,519,013 (GRCm39) nonsense probably null
R6999:Scn2a UTSW 2 65,512,453 (GRCm39) missense probably benign
R7069:Scn2a UTSW 2 65,594,950 (GRCm39) missense probably benign 0.00
R7073:Scn2a UTSW 2 65,558,787 (GRCm39) missense probably benign 0.00
R7125:Scn2a UTSW 2 65,594,277 (GRCm39) missense probably damaging 1.00
R7178:Scn2a UTSW 2 65,579,197 (GRCm39) nonsense probably null
R7179:Scn2a UTSW 2 65,532,323 (GRCm39) missense probably damaging 1.00
R7203:Scn2a UTSW 2 65,578,663 (GRCm39) missense probably benign 0.01
R7227:Scn2a UTSW 2 65,582,367 (GRCm39) missense probably damaging 0.98
R7269:Scn2a UTSW 2 65,594,113 (GRCm39) missense probably damaging 1.00
R7358:Scn2a UTSW 2 65,512,850 (GRCm39) nonsense probably null
R7388:Scn2a UTSW 2 65,518,998 (GRCm39) missense probably damaging 1.00
R7491:Scn2a UTSW 2 65,532,352 (GRCm39) missense probably damaging 0.99
R7619:Scn2a UTSW 2 65,546,247 (GRCm39) missense probably damaging 1.00
R7695:Scn2a UTSW 2 65,542,251 (GRCm39) missense probably damaging 0.99
R7735:Scn2a UTSW 2 65,594,013 (GRCm39) missense probably benign 0.40
R7911:Scn2a UTSW 2 65,512,427 (GRCm39) missense probably null 1.00
R8096:Scn2a UTSW 2 65,594,366 (GRCm39) missense probably damaging 0.98
R8172:Scn2a UTSW 2 65,520,672 (GRCm39) missense probably benign 0.01
R8220:Scn2a UTSW 2 65,520,620 (GRCm39) missense probably benign 0.01
R8333:Scn2a UTSW 2 65,514,191 (GRCm39) missense probably benign 0.01
R8416:Scn2a UTSW 2 65,511,345 (GRCm39) missense probably benign 0.00
R8850:Scn2a UTSW 2 65,518,730 (GRCm39) missense probably damaging 1.00
R8897:Scn2a UTSW 2 65,546,002 (GRCm39) critical splice acceptor site probably null
R8977:Scn2a UTSW 2 65,594,014 (GRCm39) missense probably damaging 0.99
R8992:Scn2a UTSW 2 65,594,242 (GRCm39) missense probably damaging 1.00
R9190:Scn2a UTSW 2 65,511,346 (GRCm39) missense probably benign 0.00
R9206:Scn2a UTSW 2 65,548,131 (GRCm39) missense probably damaging 1.00
R9355:Scn2a UTSW 2 65,594,433 (GRCm39) missense probably damaging 1.00
R9452:Scn2a UTSW 2 65,595,163 (GRCm39) missense probably benign
R9529:Scn2a UTSW 2 65,594,932 (GRCm39) missense probably damaging 0.99
R9567:Scn2a UTSW 2 65,518,974 (GRCm39) missense probably damaging 1.00
R9569:Scn2a UTSW 2 65,560,622 (GRCm39) missense probably damaging 1.00
R9657:Scn2a UTSW 2 65,566,032 (GRCm39) missense probably damaging 1.00
R9715:Scn2a UTSW 2 65,579,149 (GRCm39) missense possibly damaging 0.93
R9761:Scn2a UTSW 2 65,566,030 (GRCm39) missense probably damaging 1.00
Z1176:Scn2a UTSW 2 65,582,212 (GRCm39) missense possibly damaging 0.84
Z1177:Scn2a UTSW 2 65,548,079 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ATCCAGTCGGTGAAGAAGCTGTCTG -3'
(R):5'- AGATCATGCACGTTGAAATGGCTACTT -3'

Sequencing Primer
(F):5'- TTCATGGGCAACCTGAGGAA -3'
(R):5'- CACGTTGAAATGGCTACTTTCATC -3'
Posted On 2014-03-14