Incidental Mutation 'R1448:Or14a256'
ID 159042
Institutional Source Beutler Lab
Gene Symbol Or14a256
Ensembl Gene ENSMUSG00000062042
Gene Name olfactory receptor family 14 subfamily A member 256
Synonyms Olfr294, MOR219-5, GA_x6K02T2NHDJ-9504525-9505532
MMRRC Submission 039503-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.146) question?
Stock # R1448 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 86264844-86265851 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86265569 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 95 (C95S)
Ref Sequence ENSEMBL: ENSMUSP00000077662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078588]
AlphaFold F7CWV4
Predicted Effect probably damaging
Transcript: ENSMUST00000078588
AA Change: C95S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077662
Gene: ENSMUSG00000062042
AA Change: C95S

DomainStartEndE-ValueType
Pfam:7tm_4 29 309 1.2e-38 PFAM
Pfam:7tm_1 39 288 1.8e-22 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417H12Rik T A 7: 107,223,952 (GRCm39) probably benign Het
A1cf A T 19: 31,886,196 (GRCm39) N35I possibly damaging Het
Abca2 T C 2: 25,330,542 (GRCm39) I1106T possibly damaging Het
Abca4 G A 3: 121,956,577 (GRCm39) probably null Het
Adgrv1 T C 13: 81,581,632 (GRCm39) D4804G probably benign Het
Adk T A 14: 21,102,708 (GRCm39) M1K probably null Het
Aff3 T C 1: 38,230,364 (GRCm39) N1006D probably damaging Het
Akap12 A G 10: 4,305,475 (GRCm39) T762A probably benign Het
Atosa C G 9: 74,917,456 (GRCm39) S685* probably null Het
Atp12a T A 14: 56,623,296 (GRCm39) M843K probably damaging Het
Bbx T A 16: 50,086,633 (GRCm39) K169* probably null Het
Bicra A T 7: 15,722,284 (GRCm39) V411E possibly damaging Het
Camk1d A T 2: 5,366,836 (GRCm39) Y126* probably null Het
Cel T C 2: 28,446,338 (GRCm39) Y511C probably damaging Het
Celf4 G T 18: 25,636,140 (GRCm39) probably null Het
Clasp1 A G 1: 118,436,646 (GRCm39) N310S probably benign Het
Col6a3 T C 1: 90,709,577 (GRCm39) K1873R unknown Het
Cstf1 A G 2: 172,217,795 (GRCm39) D136G probably damaging Het
Cwc22 T A 2: 77,741,899 (GRCm39) E470D probably damaging Het
Cxcr2 A T 1: 74,197,527 (GRCm39) D7V probably benign Het
Cytip A G 2: 58,035,192 (GRCm39) I168T probably damaging Het
D5Ertd579e A G 5: 36,760,083 (GRCm39) L1359P probably benign Het
Ddx25 A C 9: 35,469,034 (GRCm39) V26G probably benign Het
Dennd4a T A 9: 64,813,327 (GRCm39) S1429T possibly damaging Het
Dmd A G X: 83,892,306 (GRCm39) D2990G probably damaging Het
Dop1a C A 9: 86,424,785 (GRCm39) probably null Het
Eps8 T C 6: 137,499,852 (GRCm39) Q209R possibly damaging Het
Fabp6 T A 11: 43,486,992 (GRCm39) I112F probably benign Het
Fbxw10 T C 11: 62,738,418 (GRCm39) V104A possibly damaging Het
Gp1ba C T 11: 70,532,253 (GRCm39) P673L probably damaging Het
Grin3a T C 4: 49,702,804 (GRCm39) Y894C probably damaging Het
Hydin C T 8: 111,173,217 (GRCm39) H967Y probably benign Het
Ip6k3 T C 17: 27,364,242 (GRCm39) K269E possibly damaging Het
Jup T C 11: 100,274,026 (GRCm39) K172E probably damaging Het
Katnal1 T C 5: 148,841,486 (GRCm39) D126G probably benign Het
Knl1 A T 2: 118,898,788 (GRCm39) K163M probably damaging Het
Krt17 C T 11: 100,148,365 (GRCm39) E359K possibly damaging Het
Lct T A 1: 128,235,559 (GRCm39) I483F probably damaging Het
Loxl2 G A 14: 69,930,489 (GRCm39) G751D probably damaging Het
Ltbp4 G A 7: 27,006,002 (GRCm39) R1559C possibly damaging Het
Man2c1 T A 9: 57,042,503 (GRCm39) D183E probably benign Het
Med17 T C 9: 15,187,139 (GRCm39) probably null Het
Mrgpra9 A C 7: 46,885,561 (GRCm39) S34R probably benign Het
Mrpl44 T A 1: 79,755,677 (GRCm39) N94K probably damaging Het
Nat8f1 A G 6: 85,887,924 (GRCm39) V12A probably benign Het
Nr2e3 C A 9: 59,850,797 (GRCm39) G354V probably damaging Het
Nrbp1 T A 5: 31,403,157 (GRCm39) I210N probably damaging Het
Nup155 T C 15: 8,141,890 (GRCm39) V94A probably benign Het
Or52h2 C T 7: 103,839,082 (GRCm39) V111I possibly damaging Het
Or5p76 T C 7: 108,122,525 (GRCm39) I211V probably benign Het
Or9q2 A T 19: 13,772,140 (GRCm39) Y278* probably null Het
Pcdhb10 A T 18: 37,545,556 (GRCm39) I211F possibly damaging Het
Phip A C 9: 82,797,476 (GRCm39) I509S possibly damaging Het
Pkhd1 C T 1: 20,655,381 (GRCm39) probably null Het
Psme4 T G 11: 30,802,744 (GRCm39) L1487R probably damaging Het
Ptgdr2 A G 19: 10,917,857 (GRCm39) S125G probably damaging Het
Ptpro A G 6: 137,418,114 (GRCm39) K126E probably damaging Het
Rdh16f2 T A 10: 127,712,794 (GRCm39) V264E probably benign Het
Ric8b C T 10: 84,783,535 (GRCm39) A131V possibly damaging Het
Rock1 A T 18: 10,070,233 (GRCm39) I1280N probably damaging Het
Rprd2 A G 3: 95,725,888 (GRCm39) V59A possibly damaging Het
Ruvbl1 T A 6: 88,444,551 (GRCm39) C49S probably benign Het
Scn2a A G 2: 65,514,189 (GRCm39) N291S probably benign Het
Serbp1 T A 6: 67,254,904 (GRCm39) H325Q probably damaging Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Shisal2b T C 13: 104,982,470 (GRCm39) I151V probably benign Het
Slitrk3 G A 3: 72,957,674 (GRCm39) T366I probably damaging Het
Spryd3 A T 15: 102,026,827 (GRCm39) H307Q possibly damaging Het
Spx A T 6: 142,364,239 (GRCm39) D100V probably benign Het
Surf4 A G 2: 26,814,476 (GRCm39) F142L probably damaging Het
Syne2 T A 12: 76,067,099 (GRCm39) probably null Het
Syne2 T C 12: 76,098,952 (GRCm39) M5278T possibly damaging Het
Thap12 T C 7: 98,365,230 (GRCm39) V466A probably benign Het
Thap3 T C 4: 152,067,673 (GRCm39) K135R possibly damaging Het
Tmem131 G T 1: 36,866,439 (GRCm39) D448E probably benign Het
Tmem63b C G 17: 45,989,904 (GRCm39) R88P possibly damaging Het
Trim43a G T 9: 88,464,146 (GRCm39) C19F probably damaging Het
Trp63 C T 16: 25,707,870 (GRCm39) P526L possibly damaging Het
Ubqln3 T C 7: 103,791,997 (GRCm39) D31G probably damaging Het
Utp14b C A 1: 78,643,162 (GRCm39) N353K probably damaging Het
Vmn1r40 A G 6: 89,691,558 (GRCm39) K125R probably damaging Het
Vmn2r1 A G 3: 64,008,734 (GRCm39) Y471C probably damaging Het
Vmn2r13 A G 5: 109,322,001 (GRCm39) I232T probably damaging Het
Zfp263 A C 16: 3,564,323 (GRCm39) E204D probably benign Het
Zfp865 A T 7: 5,032,278 (GRCm39) K88* probably null Het
Other mutations in Or14a256
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Or14a256 APN 7 86,265,205 (GRCm39) missense probably damaging 1.00
IGL02617:Or14a256 APN 7 86,264,872 (GRCm39) missense probably benign 0.14
IGL02694:Or14a256 APN 7 86,265,518 (GRCm39) missense probably benign 0.00
IGL02828:Or14a256 APN 7 86,265,277 (GRCm39) missense possibly damaging 0.67
IGL03229:Or14a256 APN 7 86,265,286 (GRCm39) missense probably benign 0.00
IGL03351:Or14a256 APN 7 86,264,885 (GRCm39) missense possibly damaging 0.68
PIT4802001:Or14a256 UTSW 7 86,265,763 (GRCm39) missense probably null 1.00
R0848:Or14a256 UTSW 7 86,264,848 (GRCm39) missense probably damaging 0.96
R1720:Or14a256 UTSW 7 86,265,664 (GRCm39) missense probably damaging 1.00
R1734:Or14a256 UTSW 7 86,265,425 (GRCm39) missense probably benign 0.07
R1959:Or14a256 UTSW 7 86,265,639 (GRCm39) missense probably benign 0.00
R2116:Or14a256 UTSW 7 86,265,286 (GRCm39) missense probably benign 0.00
R2518:Or14a256 UTSW 7 86,265,395 (GRCm39) missense probably benign 0.03
R3034:Or14a256 UTSW 7 86,264,970 (GRCm39) missense possibly damaging 0.50
R3110:Or14a256 UTSW 7 86,264,884 (GRCm39) missense probably benign
R3112:Or14a256 UTSW 7 86,264,884 (GRCm39) missense probably benign
R3690:Or14a256 UTSW 7 86,265,686 (GRCm39) missense probably damaging 1.00
R4612:Or14a256 UTSW 7 86,264,944 (GRCm39) missense probably benign 0.00
R6476:Or14a256 UTSW 7 86,265,218 (GRCm39) missense probably benign 0.04
R6895:Or14a256 UTSW 7 86,265,323 (GRCm39) missense probably damaging 1.00
R7102:Or14a256 UTSW 7 86,265,475 (GRCm39) missense probably benign 0.25
R7104:Or14a256 UTSW 7 86,264,900 (GRCm39) missense probably null 0.07
R7179:Or14a256 UTSW 7 86,265,574 (GRCm39) missense possibly damaging 0.76
R7256:Or14a256 UTSW 7 86,264,873 (GRCm39) missense probably benign 0.03
R7624:Or14a256 UTSW 7 86,265,769 (GRCm39) missense possibly damaging 0.47
R8422:Or14a256 UTSW 7 86,265,466 (GRCm39) missense probably benign 0.13
R9432:Or14a256 UTSW 7 86,265,065 (GRCm39) missense possibly damaging 0.66
R9700:Or14a256 UTSW 7 86,265,618 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGACCACAAGTGTGTCAGAGCAG -3'
(R):5'- CGCTCATCACCCTGGATCTGAAAC -3'

Sequencing Primer
(F):5'- TGTCAGAGCAGGAGATCCTTAAC -3'
(R):5'- AACTCCAAACACCCATGTACTTTTTC -3'
Posted On 2014-03-14