Incidental Mutation 'R1448:Thap12'
ID 159043
Institutional Source Beutler Lab
Gene Symbol Thap12
Ensembl Gene ENSMUSG00000030753
Gene Name THAP domain containing 12
Synonyms Prkrir, Dap4, 2900052B10Rik
MMRRC Submission 039503-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock # R1448 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 98703103-98718062 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98716023 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 466 (V466A)
Ref Sequence ENSEMBL: ENSMUSP00000033009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033009] [ENSMUST00000126356] [ENSMUST00000153566]
AlphaFold Q9CUX1
Predicted Effect probably benign
Transcript: ENSMUST00000033009
AA Change: V466A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000033009
Gene: ENSMUSG00000030753
AA Change: V466A

DomainStartEndE-ValueType
THAP 3 92 8.38e-22 SMART
DM3 21 91 1.49e-20 SMART
Pfam:DUF4371 112 338 1.9e-22 PFAM
low complexity region 433 445 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 631 726 6.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126356
SMART Domains Protein: ENSMUSP00000118403
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 78 3.21e-9 SMART
DM3 21 78 1.89e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146473
Predicted Effect probably benign
Transcript: ENSMUST00000153566
SMART Domains Protein: ENSMUSP00000118736
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 92 8.38e-22 SMART
DM3 21 91 1.49e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208543
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417H12Rik T A 7: 107,624,745 probably benign Het
A1cf A T 19: 31,908,796 N35I possibly damaging Het
Abca2 T C 2: 25,440,530 I1106T possibly damaging Het
Abca4 G A 3: 122,162,928 probably null Het
Adgrv1 T C 13: 81,433,513 D4804G probably benign Het
Adk T A 14: 21,052,640 M1K probably null Het
Aff3 T C 1: 38,191,283 N1006D probably damaging Het
Akap12 A G 10: 4,355,475 T762A probably benign Het
Atp12a T A 14: 56,385,839 M843K probably damaging Het
Bbx T A 16: 50,266,270 K169* probably null Het
Bicra A T 7: 15,988,359 V411E possibly damaging Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Cel T C 2: 28,556,326 Y511C probably damaging Het
Celf4 G T 18: 25,503,083 probably null Het
Clasp1 A G 1: 118,508,916 N310S probably benign Het
Col6a3 T C 1: 90,781,855 K1873R unknown Het
Cstf1 A G 2: 172,375,875 D136G probably damaging Het
Cwc22 T A 2: 77,911,555 E470D probably damaging Het
Cxcr2 A T 1: 74,158,368 D7V probably benign Het
Cytip A G 2: 58,145,180 I168T probably damaging Het
D5Ertd579e A G 5: 36,602,739 L1359P probably benign Het
Ddx25 A C 9: 35,557,738 V26G probably benign Het
Dennd4a T A 9: 64,906,045 S1429T possibly damaging Het
Dmd A G X: 84,848,700 D2990G probably damaging Het
Dopey1 C A 9: 86,542,732 probably null Het
Eps8 T C 6: 137,522,854 Q209R possibly damaging Het
Fabp6 T A 11: 43,596,165 I112F probably benign Het
Fam159b T C 13: 104,845,962 I151V probably benign Het
Fam214a C G 9: 75,010,174 S685* probably null Het
Fbxw10 T C 11: 62,847,592 V104A possibly damaging Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Grin3a T C 4: 49,702,804 Y894C probably damaging Het
Hydin C T 8: 110,446,585 H967Y probably benign Het
Ip6k3 T C 17: 27,145,268 K269E possibly damaging Het
Jup T C 11: 100,383,200 K172E probably damaging Het
Katnal1 T C 5: 148,904,676 D126G probably benign Het
Knl1 A T 2: 119,068,307 K163M probably damaging Het
Krt17 C T 11: 100,257,539 E359K possibly damaging Het
Lct T A 1: 128,307,822 I483F probably damaging Het
Loxl2 G A 14: 69,693,040 G751D probably damaging Het
Ltbp4 G A 7: 27,306,577 R1559C possibly damaging Het
Man2c1 T A 9: 57,135,219 D183E probably benign Het
Med17 T C 9: 15,275,843 probably null Het
Mrgpra9 A C 7: 47,235,813 S34R probably benign Het
Mrpl44 T A 1: 79,777,960 N94K probably damaging Het
Nat8f1 A G 6: 85,910,942 V12A probably benign Het
Nr2e3 C A 9: 59,943,514 G354V probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup155 T C 15: 8,112,406 V94A probably benign Het
Olfr1497 A T 19: 13,794,776 Y278* probably null Het
Olfr294 A T 7: 86,616,361 C95S probably damaging Het
Olfr502 T C 7: 108,523,318 I211V probably benign Het
Olfr649 C T 7: 104,189,875 V111I possibly damaging Het
Pcdhb10 A T 18: 37,412,503 I211F possibly damaging Het
Phip A C 9: 82,915,423 I509S possibly damaging Het
Pkhd1 C T 1: 20,585,157 probably null Het
Psme4 T G 11: 30,852,744 L1487R probably damaging Het
Ptgdr2 A G 19: 10,940,493 S125G probably damaging Het
Ptpro A G 6: 137,441,116 K126E probably damaging Het
Rdh16f2 T A 10: 127,876,925 V264E probably benign Het
Ric8b C T 10: 84,947,671 A131V possibly damaging Het
Rock1 A T 18: 10,070,233 I1280N probably damaging Het
Rprd2 A G 3: 95,818,576 V59A possibly damaging Het
Ruvbl1 T A 6: 88,467,569 C49S probably benign Het
Scn2a A G 2: 65,683,845 N291S probably benign Het
Serbp1 T A 6: 67,277,920 H325Q probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slitrk3 G A 3: 73,050,341 T366I probably damaging Het
Spryd3 A T 15: 102,118,392 H307Q possibly damaging Het
Spx A T 6: 142,418,513 D100V probably benign Het
Surf4 A G 2: 26,924,464 F142L probably damaging Het
Syne2 T A 12: 76,020,325 probably null Het
Syne2 T C 12: 76,052,178 M5278T possibly damaging Het
Thap3 T C 4: 151,983,216 K135R possibly damaging Het
Tmem131 G T 1: 36,827,358 D448E probably benign Het
Tmem63b C G 17: 45,678,978 R88P possibly damaging Het
Trim43a G T 9: 88,582,093 C19F probably damaging Het
Trp63 C T 16: 25,889,120 P526L possibly damaging Het
Ubqln3 T C 7: 104,142,790 D31G probably damaging Het
Utp14b C A 1: 78,665,445 N353K probably damaging Het
Vmn1r40 A G 6: 89,714,576 K125R probably damaging Het
Vmn2r1 A G 3: 64,101,313 Y471C probably damaging Het
Vmn2r13 A G 5: 109,174,135 I232T probably damaging Het
Zfp263 A C 16: 3,746,459 E204D probably benign Het
Zfp865 A T 7: 5,029,279 K88* probably null Het
Other mutations in Thap12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Thap12 APN 7 98716137 missense possibly damaging 0.82
IGL01145:Thap12 APN 7 98712903 makesense probably null
IGL01973:Thap12 APN 7 98716499 missense possibly damaging 0.58
IGL02404:Thap12 APN 7 98710133 missense probably damaging 1.00
H8562:Thap12 UTSW 7 98715107 missense probably damaging 0.98
PIT4453001:Thap12 UTSW 7 98715038 missense probably benign 0.00
R0090:Thap12 UTSW 7 98715893 missense probably damaging 1.00
R0254:Thap12 UTSW 7 98715281 missense probably benign 0.03
R1344:Thap12 UTSW 7 98716830 missense probably damaging 0.97
R1384:Thap12 UTSW 7 98703438 missense probably damaging 0.98
R1418:Thap12 UTSW 7 98716830 missense probably damaging 0.97
R1493:Thap12 UTSW 7 98715438 missense probably benign 0.30
R1906:Thap12 UTSW 7 98716740 missense probably damaging 1.00
R1932:Thap12 UTSW 7 98716838 missense possibly damaging 0.77
R1992:Thap12 UTSW 7 98716365 missense possibly damaging 0.68
R2044:Thap12 UTSW 7 98716620 missense probably damaging 1.00
R2092:Thap12 UTSW 7 98716449 missense possibly damaging 0.70
R2160:Thap12 UTSW 7 98710126 missense probably damaging 0.97
R3850:Thap12 UTSW 7 98716663 missense probably damaging 1.00
R4086:Thap12 UTSW 7 98716494 missense possibly damaging 0.94
R4162:Thap12 UTSW 7 98710078 intron probably benign
R4554:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4555:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4556:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4557:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4659:Thap12 UTSW 7 98710091 intron probably benign
R4734:Thap12 UTSW 7 98715954 missense probably damaging 0.98
R4734:Thap12 UTSW 7 98715955 nonsense probably null
R5794:Thap12 UTSW 7 98716393 missense probably benign 0.11
R5994:Thap12 UTSW 7 98716030 nonsense probably null
R6298:Thap12 UTSW 7 98703405 missense probably damaging 1.00
R6515:Thap12 UTSW 7 98707095 missense probably damaging 0.97
R6624:Thap12 UTSW 7 98715586 nonsense probably null
R6625:Thap12 UTSW 7 98716070 missense probably benign 0.00
R6965:Thap12 UTSW 7 98715462 missense probably damaging 1.00
R7560:Thap12 UTSW 7 98710231 missense probably damaging 0.99
R8713:Thap12 UTSW 7 98707076 missense probably benign 0.30
R8897:Thap12 UTSW 7 98715327 missense probably benign 0.38
R9099:Thap12 UTSW 7 98715393 missense probably damaging 1.00
R9260:Thap12 UTSW 7 98707073 nonsense probably null
R9339:Thap12 UTSW 7 98715116 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AATTTGTCATTCCCAGTGGACAGGC -3'
(R):5'- TGTACATGTCAGCATGGTGCTCTTC -3'

Sequencing Primer
(F):5'- TGGACAGGCAGGCATGATG -3'
(R):5'- TCTACTGTTGGAACACTGAGAG -3'
Posted On 2014-03-14