Incidental Mutation 'R1448:Ubqln3'
ID 159044
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Name ubiquilin 3
Synonyms 4933400K24Rik
MMRRC Submission 039503-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R1448 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 104140623-104143279 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 104142790 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 31 (D31G)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254]
AlphaFold Q8C5U9
Predicted Effect probably damaging
Transcript: ENSMUST00000057254
AA Change: D31G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: D31G

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417H12Rik T A 7: 107,624,745 (GRCm38) probably benign Het
A1cf A T 19: 31,908,796 (GRCm38) N35I possibly damaging Het
Abca2 T C 2: 25,440,530 (GRCm38) I1106T possibly damaging Het
Abca4 G A 3: 122,162,928 (GRCm38) probably null Het
Adgrv1 T C 13: 81,433,513 (GRCm38) D4804G probably benign Het
Adk T A 14: 21,052,640 (GRCm38) M1K probably null Het
Aff3 T C 1: 38,191,283 (GRCm38) N1006D probably damaging Het
Akap12 A G 10: 4,355,475 (GRCm38) T762A probably benign Het
Atosa C G 9: 75,010,174 (GRCm38) S685* probably null Het
Atp12a T A 14: 56,385,839 (GRCm38) M843K probably damaging Het
Bbx T A 16: 50,266,270 (GRCm38) K169* probably null Het
Bicra A T 7: 15,988,359 (GRCm38) V411E possibly damaging Het
Camk1d A T 2: 5,362,025 (GRCm38) Y126* probably null Het
Cel T C 2: 28,556,326 (GRCm38) Y511C probably damaging Het
Celf4 G T 18: 25,503,083 (GRCm38) probably null Het
Clasp1 A G 1: 118,508,916 (GRCm38) N310S probably benign Het
Col6a3 T C 1: 90,781,855 (GRCm38) K1873R unknown Het
Cstf1 A G 2: 172,375,875 (GRCm38) D136G probably damaging Het
Cwc22 T A 2: 77,911,555 (GRCm38) E470D probably damaging Het
Cxcr2 A T 1: 74,158,368 (GRCm38) D7V probably benign Het
Cytip A G 2: 58,145,180 (GRCm38) I168T probably damaging Het
D5Ertd579e A G 5: 36,602,739 (GRCm38) L1359P probably benign Het
Ddx25 A C 9: 35,557,738 (GRCm38) V26G probably benign Het
Dennd4a T A 9: 64,906,045 (GRCm38) S1429T possibly damaging Het
Dmd A G X: 84,848,700 (GRCm38) D2990G probably damaging Het
Dop1a C A 9: 86,542,732 (GRCm38) probably null Het
Eps8 T C 6: 137,522,854 (GRCm38) Q209R possibly damaging Het
Fabp6 T A 11: 43,596,165 (GRCm38) I112F probably benign Het
Fbxw10 T C 11: 62,847,592 (GRCm38) V104A possibly damaging Het
Gp1ba C T 11: 70,641,427 (GRCm38) P673L probably damaging Het
Grin3a T C 4: 49,702,804 (GRCm38) Y894C probably damaging Het
Hydin C T 8: 110,446,585 (GRCm38) H967Y probably benign Het
Ip6k3 T C 17: 27,145,268 (GRCm38) K269E possibly damaging Het
Jup T C 11: 100,383,200 (GRCm38) K172E probably damaging Het
Katnal1 T C 5: 148,904,676 (GRCm38) D126G probably benign Het
Knl1 A T 2: 119,068,307 (GRCm38) K163M probably damaging Het
Krt17 C T 11: 100,257,539 (GRCm38) E359K possibly damaging Het
Lct T A 1: 128,307,822 (GRCm38) I483F probably damaging Het
Loxl2 G A 14: 69,693,040 (GRCm38) G751D probably damaging Het
Ltbp4 G A 7: 27,306,577 (GRCm38) R1559C possibly damaging Het
Man2c1 T A 9: 57,135,219 (GRCm38) D183E probably benign Het
Med17 T C 9: 15,275,843 (GRCm38) probably null Het
Mrgpra9 A C 7: 47,235,813 (GRCm38) S34R probably benign Het
Mrpl44 T A 1: 79,777,960 (GRCm38) N94K probably damaging Het
Nat8f1 A G 6: 85,910,942 (GRCm38) V12A probably benign Het
Nr2e3 C A 9: 59,943,514 (GRCm38) G354V probably damaging Het
Nrbp1 T A 5: 31,245,813 (GRCm38) I210N probably damaging Het
Nup155 T C 15: 8,112,406 (GRCm38) V94A probably benign Het
Or14a256 A T 7: 86,616,361 (GRCm38) C95S probably damaging Het
Or52h2 C T 7: 104,189,875 (GRCm38) V111I possibly damaging Het
Or5p76 T C 7: 108,523,318 (GRCm38) I211V probably benign Het
Or9q2 A T 19: 13,794,776 (GRCm38) Y278* probably null Het
Pcdhb10 A T 18: 37,412,503 (GRCm38) I211F possibly damaging Het
Phip A C 9: 82,915,423 (GRCm38) I509S possibly damaging Het
Pkhd1 C T 1: 20,585,157 (GRCm38) probably null Het
Psme4 T G 11: 30,852,744 (GRCm38) L1487R probably damaging Het
Ptgdr2 A G 19: 10,940,493 (GRCm38) S125G probably damaging Het
Ptpro A G 6: 137,441,116 (GRCm38) K126E probably damaging Het
Rdh16f2 T A 10: 127,876,925 (GRCm38) V264E probably benign Het
Ric8b C T 10: 84,947,671 (GRCm38) A131V possibly damaging Het
Rock1 A T 18: 10,070,233 (GRCm38) I1280N probably damaging Het
Rprd2 A G 3: 95,818,576 (GRCm38) V59A possibly damaging Het
Ruvbl1 T A 6: 88,467,569 (GRCm38) C49S probably benign Het
Scn2a A G 2: 65,683,845 (GRCm38) N291S probably benign Het
Serbp1 T A 6: 67,277,920 (GRCm38) H325Q probably damaging Het
Shf G A 2: 122,368,682 (GRCm38) P51S probably damaging Het
Shisal2b T C 13: 104,845,962 (GRCm38) I151V probably benign Het
Slitrk3 G A 3: 73,050,341 (GRCm38) T366I probably damaging Het
Spryd3 A T 15: 102,118,392 (GRCm38) H307Q possibly damaging Het
Spx A T 6: 142,418,513 (GRCm38) D100V probably benign Het
Surf4 A G 2: 26,924,464 (GRCm38) F142L probably damaging Het
Syne2 T A 12: 76,020,325 (GRCm38) probably null Het
Syne2 T C 12: 76,052,178 (GRCm38) M5278T possibly damaging Het
Thap12 T C 7: 98,716,023 (GRCm38) V466A probably benign Het
Thap3 T C 4: 151,983,216 (GRCm38) K135R possibly damaging Het
Tmem131 G T 1: 36,827,358 (GRCm38) D448E probably benign Het
Tmem63b C G 17: 45,678,978 (GRCm38) R88P possibly damaging Het
Trim43a G T 9: 88,582,093 (GRCm38) C19F probably damaging Het
Trp63 C T 16: 25,889,120 (GRCm38) P526L possibly damaging Het
Utp14b C A 1: 78,665,445 (GRCm38) N353K probably damaging Het
Vmn1r40 A G 6: 89,714,576 (GRCm38) K125R probably damaging Het
Vmn2r1 A G 3: 64,101,313 (GRCm38) Y471C probably damaging Het
Vmn2r13 A G 5: 109,174,135 (GRCm38) I232T probably damaging Het
Zfp263 A C 16: 3,746,459 (GRCm38) E204D probably benign Het
Zfp865 A T 7: 5,029,279 (GRCm38) K88* probably null Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 104,141,777 (GRCm38) missense probably benign 0.00
IGL00766:Ubqln3 APN 7 104,142,824 (GRCm38) missense probably benign 0.00
IGL01451:Ubqln3 APN 7 104,142,196 (GRCm38) missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 104,142,398 (GRCm38) missense probably benign 0.12
IGL01705:Ubqln3 APN 7 104,142,677 (GRCm38) missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 104,142,882 (GRCm38) utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 104,142,316 (GRCm38) missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 104,141,299 (GRCm38) missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 104,142,518 (GRCm38) missense probably benign 0.02
IGL02657:Ubqln3 APN 7 104,141,963 (GRCm38) missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 104,142,065 (GRCm38) missense probably benign 0.19
IGL02709:Ubqln3 APN 7 104,141,336 (GRCm38) missense probably benign 0.12
IGL03357:Ubqln3 APN 7 104,142,556 (GRCm38) missense probably benign
PIT4544001:Ubqln3 UTSW 7 104,141,343 (GRCm38) missense probably damaging 0.97
R0180:Ubqln3 UTSW 7 104,141,840 (GRCm38) missense probably damaging 1.00
R0845:Ubqln3 UTSW 7 104,142,068 (GRCm38) missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 104,141,386 (GRCm38) missense probably benign 0.00
R1280:Ubqln3 UTSW 7 104,142,076 (GRCm38) missense possibly damaging 0.85
R1550:Ubqln3 UTSW 7 104,141,546 (GRCm38) missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 104,142,860 (GRCm38) missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 104,141,021 (GRCm38) missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 104,142,151 (GRCm38) missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 104,142,311 (GRCm38) missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 104,141,635 (GRCm38) nonsense probably null
R2366:Ubqln3 UTSW 7 104,141,049 (GRCm38) missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 104,141,803 (GRCm38) missense probably benign 0.00
R4447:Ubqln3 UTSW 7 104,142,814 (GRCm38) missense probably benign 0.31
R4509:Ubqln3 UTSW 7 104,141,444 (GRCm38) missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 104,142,491 (GRCm38) missense probably benign 0.00
R5416:Ubqln3 UTSW 7 104,141,672 (GRCm38) missense probably benign 0.34
R5617:Ubqln3 UTSW 7 104,142,433 (GRCm38) missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 104,140,910 (GRCm38) missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 104,141,467 (GRCm38) missense probably benign 0.00
R5723:Ubqln3 UTSW 7 104,141,467 (GRCm38) missense probably benign 0.00
R5724:Ubqln3 UTSW 7 104,141,467 (GRCm38) missense probably benign 0.00
R5819:Ubqln3 UTSW 7 104,141,467 (GRCm38) missense probably benign 0.00
R5820:Ubqln3 UTSW 7 104,141,467 (GRCm38) missense probably benign 0.00
R5966:Ubqln3 UTSW 7 104,141,699 (GRCm38) missense probably benign 0.03
R6260:Ubqln3 UTSW 7 104,142,317 (GRCm38) nonsense probably null
R6272:Ubqln3 UTSW 7 104,142,178 (GRCm38) missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 104,141,617 (GRCm38) missense probably benign 0.00
R6936:Ubqln3 UTSW 7 104,142,310 (GRCm38) missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 104,141,423 (GRCm38) missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 104,141,275 (GRCm38) missense probably benign 0.01
R7079:Ubqln3 UTSW 7 104,141,371 (GRCm38) missense probably benign 0.12
R7733:Ubqln3 UTSW 7 104,141,076 (GRCm38) missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 104,141,236 (GRCm38) missense possibly damaging 0.52
R7919:Ubqln3 UTSW 7 104,141,192 (GRCm38) missense probably benign 0.03
R7961:Ubqln3 UTSW 7 104,142,590 (GRCm38) missense probably benign 0.00
R8009:Ubqln3 UTSW 7 104,142,590 (GRCm38) missense probably benign 0.00
R9619:Ubqln3 UTSW 7 104,141,846 (GRCm38) missense probably benign 0.05
R9652:Ubqln3 UTSW 7 104,142,755 (GRCm38) missense probably damaging 1.00
RF054:Ubqln3 UTSW 7 104,141,178 (GRCm38) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CACTCCACACTGTGCCAATGAGTC -3'
(R):5'- TTCCAAGTGACCTAGTGGTCCTCTC -3'

Sequencing Primer
(F):5'- GTGCCAATGAGTCAGGGTC -3'
(R):5'- TAGATCCAAGGCCCTCCTTATAC -3'
Posted On 2014-03-14