Mutagenetix > Incidental Mutation

Incidental Mutation 'R1448:Psme4'

159063

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

039503-MU

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1448 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 30852744 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 1487 (L1487R)

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231] [ENSMUST00000129824]

AlphaFold

Q5SSW2

Predicted Effect

probably damaging
Transcript: ENSMUST00000041231
AA Change: L1487R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: L1487R

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129824

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 94.6%
20x: 87.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417H12Rik	T	A	7: 107,624,745		probably benign	Het
A1cf	A	T	19: 31,908,796	N35I	possibly damaging	Het
Abca2	T	C	2: 25,440,530	I1106T	possibly damaging	Het
Abca4	G	A	3: 122,162,928		probably null	Het
Adgrv1	T	C	13: 81,433,513	D4804G	probably benign	Het
Adk	T	A	14: 21,052,640	M1K	probably null	Het
Aff3	T	C	1: 38,191,283	N1006D	probably damaging	Het
Akap12	A	G	10: 4,355,475	T762A	probably benign	Het
Atp12a	T	A	14: 56,385,839	M843K	probably damaging	Het
Bbx	T	A	16: 50,266,270	K169*	probably null	Het
Bicra	A	T	7: 15,988,359	V411E	possibly damaging	Het
Camk1d	A	T	2: 5,362,025	Y126*	probably null	Het
Cel	T	C	2: 28,556,326	Y511C	probably damaging	Het
Celf4	G	T	18: 25,503,083		probably null	Het
Clasp1	A	G	1: 118,508,916	N310S	probably benign	Het
Col6a3	T	C	1: 90,781,855	K1873R	unknown	Het
Cstf1	A	G	2: 172,375,875	D136G	probably damaging	Het
Cwc22	T	A	2: 77,911,555	E470D	probably damaging	Het
Cxcr2	A	T	1: 74,158,368	D7V	probably benign	Het
Cytip	A	G	2: 58,145,180	I168T	probably damaging	Het
D5Ertd579e	A	G	5: 36,602,739	L1359P	probably benign	Het
Ddx25	A	C	9: 35,557,738	V26G	probably benign	Het
Dennd4a	T	A	9: 64,906,045	S1429T	possibly damaging	Het
Dmd	A	G	X: 84,848,700	D2990G	probably damaging	Het
Dopey1	C	A	9: 86,542,732		probably null	Het
Eps8	T	C	6: 137,522,854	Q209R	possibly damaging	Het
Fabp6	T	A	11: 43,596,165	I112F	probably benign	Het
Fam159b	T	C	13: 104,845,962	I151V	probably benign	Het
Fam214a	C	G	9: 75,010,174	S685*	probably null	Het
Fbxw10	T	C	11: 62,847,592	V104A	possibly damaging	Het
Gp1ba	C	T	11: 70,641,427	P673L	probably damaging	Het
Grin3a	T	C	4: 49,702,804	Y894C	probably damaging	Het
Hydin	C	T	8: 110,446,585	H967Y	probably benign	Het
Ip6k3	T	C	17: 27,145,268	K269E	possibly damaging	Het
Jup	T	C	11: 100,383,200	K172E	probably damaging	Het
Katnal1	T	C	5: 148,904,676	D126G	probably benign	Het
Knl1	A	T	2: 119,068,307	K163M	probably damaging	Het
Krt17	C	T	11: 100,257,539	E359K	possibly damaging	Het
Lct	T	A	1: 128,307,822	I483F	probably damaging	Het
Loxl2	G	A	14: 69,693,040	G751D	probably damaging	Het
Ltbp4	G	A	7: 27,306,577	R1559C	possibly damaging	Het
Man2c1	T	A	9: 57,135,219	D183E	probably benign	Het
Med17	T	C	9: 15,275,843		probably null	Het
Mrgpra9	A	C	7: 47,235,813	S34R	probably benign	Het
Mrpl44	T	A	1: 79,777,960	N94K	probably damaging	Het
Nat8f1	A	G	6: 85,910,942	V12A	probably benign	Het
Nr2e3	C	A	9: 59,943,514	G354V	probably damaging	Het
Nrbp1	T	A	5: 31,245,813	I210N	probably damaging	Het
Nup155	T	C	15: 8,112,406	V94A	probably benign	Het
Olfr1497	A	T	19: 13,794,776	Y278*	probably null	Het
Olfr294	A	T	7: 86,616,361	C95S	probably damaging	Het
Olfr502	T	C	7: 108,523,318	I211V	probably benign	Het
Olfr649	C	T	7: 104,189,875	V111I	possibly damaging	Het
Pcdhb10	A	T	18: 37,412,503	I211F	possibly damaging	Het
Phip	A	C	9: 82,915,423	I509S	possibly damaging	Het
Pkhd1	C	T	1: 20,585,157		probably null	Het
Ptgdr2	A	G	19: 10,940,493	S125G	probably damaging	Het
Ptpro	A	G	6: 137,441,116	K126E	probably damaging	Het
Rdh16f2	T	A	10: 127,876,925	V264E	probably benign	Het
Ric8b	C	T	10: 84,947,671	A131V	possibly damaging	Het
Rock1	A	T	18: 10,070,233	I1280N	probably damaging	Het
Rprd2	A	G	3: 95,818,576	V59A	possibly damaging	Het
Ruvbl1	T	A	6: 88,467,569	C49S	probably benign	Het
Scn2a	A	G	2: 65,683,845	N291S	probably benign	Het
Serbp1	T	A	6: 67,277,920	H325Q	probably damaging	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Slitrk3	G	A	3: 73,050,341	T366I	probably damaging	Het
Spryd3	A	T	15: 102,118,392	H307Q	possibly damaging	Het
Spx	A	T	6: 142,418,513	D100V	probably benign	Het
Surf4	A	G	2: 26,924,464	F142L	probably damaging	Het
Syne2	T	A	12: 76,020,325		probably null	Het
Syne2	T	C	12: 76,052,178	M5278T	possibly damaging	Het
Thap12	T	C	7: 98,716,023	V466A	probably benign	Het
Thap3	T	C	4: 151,983,216	K135R	possibly damaging	Het
Tmem131	G	T	1: 36,827,358	D448E	probably benign	Het
Tmem63b	C	G	17: 45,678,978	R88P	possibly damaging	Het
Trim43a	G	T	9: 88,582,093	C19F	probably damaging	Het
Trp63	C	T	16: 25,889,120	P526L	possibly damaging	Het
Ubqln3	T	C	7: 104,142,790	D31G	probably damaging	Het
Utp14b	C	A	1: 78,665,445	N353K	probably damaging	Het
Vmn1r40	A	G	6: 89,714,576	K125R	probably damaging	Het
Vmn2r1	A	G	3: 64,101,313	Y471C	probably damaging	Het
Vmn2r13	A	G	5: 109,174,135	I232T	probably damaging	Het
Zfp263	A	C	16: 3,746,459	E204D	probably benign	Het
Zfp865	A	T	7: 5,029,279	K88*	probably null	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTGTTTGTGGTGATCCAAGAGAAAG -3'
(R):5'- TGAGGGGCAACCCTGTAGTATGATG -3'

Sequencing Primer
(F):5'- TCCAAGAGAAAGCAGGAAAAGATTG -3'
(R):5'- CAGTGCTCCCAATTCATATTCGAAG -3'

Posted On

2014-03-14