Mutagenetix > Incidental Mutation

Incidental Mutation 'R1448:A1cf'

159089

Institutional Source

Beutler Lab

Gene Symbol

A1cf

Ensembl Gene

ENSMUSG00000052595

Gene Name

APOBEC1 complementation factor

Synonyms

apobec-1 complementation factor, ACF, 1810073H04Rik

MMRRC Submission

039503-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R1448 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31868764-31948573 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 31908796 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 35 (N35I)

Ref Sequence

ENSEMBL: ENSMUSP00000153465 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075838] [ENSMUST00000224304] [ENSMUST00000224400] [ENSMUST00000224564]

AlphaFold

Q5YD48

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075838
AA Change: N35I

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000075235
Gene: ENSMUSG00000052595
AA Change: N35I

Domain	Start	End	E-Value	Type
RRM	57	130	2.13e-18	SMART
RRM	137	214	1.59e-8	SMART
RRM	232	299	1.36e-16	SMART
low complexity region	386	411	N/A	INTRINSIC
Pfam:DND1_DSRM	445	523	1.6e-30	PFAM
low complexity region	526	542	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224304
AA Change: N35I

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000224400

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224564
AA Change: N35I

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224809

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225165

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 94.6%
20x: 87.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian apolipoprotein B mRNA undergoes site-specific C to U deamination, which is mediated by a multi-component enzyme complex containing a minimal core composed of APOBEC-1 and a complementation factor encoded by this gene. The gene product has three non-identical RNA recognition motifs and belongs to the hnRNP R family of RNA-binding proteins. It has been proposed that this complementation factor functions as an RNA-binding subunit and docks APOBEC-1 to deaminate the upstream cytidine. Studies suggest that the protein may also be involved in other RNA editing or RNA processing events. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Embryos homozygous for a targeted deletion of this gene are detectable only until the blastocyst stage (E3.5) and isolated mutant blastocysts fail to proliferate in vitro. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417H12Rik	T	A	7: 107,624,745		probably benign	Het
Abca2	T	C	2: 25,440,530	I1106T	possibly damaging	Het
Abca4	G	A	3: 122,162,928		probably null	Het
Adgrv1	T	C	13: 81,433,513	D4804G	probably benign	Het
Adk	T	A	14: 21,052,640	M1K	probably null	Het
Aff3	T	C	1: 38,191,283	N1006D	probably damaging	Het
Akap12	A	G	10: 4,355,475	T762A	probably benign	Het
Atp12a	T	A	14: 56,385,839	M843K	probably damaging	Het
Bbx	T	A	16: 50,266,270	K169*	probably null	Het
Bicra	A	T	7: 15,988,359	V411E	possibly damaging	Het
Camk1d	A	T	2: 5,362,025	Y126*	probably null	Het
Cel	T	C	2: 28,556,326	Y511C	probably damaging	Het
Celf4	G	T	18: 25,503,083		probably null	Het
Clasp1	A	G	1: 118,508,916	N310S	probably benign	Het
Col6a3	T	C	1: 90,781,855	K1873R	unknown	Het
Cstf1	A	G	2: 172,375,875	D136G	probably damaging	Het
Cwc22	T	A	2: 77,911,555	E470D	probably damaging	Het
Cxcr2	A	T	1: 74,158,368	D7V	probably benign	Het
Cytip	A	G	2: 58,145,180	I168T	probably damaging	Het
D5Ertd579e	A	G	5: 36,602,739	L1359P	probably benign	Het
Ddx25	A	C	9: 35,557,738	V26G	probably benign	Het
Dennd4a	T	A	9: 64,906,045	S1429T	possibly damaging	Het
Dmd	A	G	X: 84,848,700	D2990G	probably damaging	Het
Dopey1	C	A	9: 86,542,732		probably null	Het
Eps8	T	C	6: 137,522,854	Q209R	possibly damaging	Het
Fabp6	T	A	11: 43,596,165	I112F	probably benign	Het
Fam159b	T	C	13: 104,845,962	I151V	probably benign	Het
Fam214a	C	G	9: 75,010,174	S685*	probably null	Het
Fbxw10	T	C	11: 62,847,592	V104A	possibly damaging	Het
Gp1ba	C	T	11: 70,641,427	P673L	probably damaging	Het
Grin3a	T	C	4: 49,702,804	Y894C	probably damaging	Het
Hydin	C	T	8: 110,446,585	H967Y	probably benign	Het
Ip6k3	T	C	17: 27,145,268	K269E	possibly damaging	Het
Jup	T	C	11: 100,383,200	K172E	probably damaging	Het
Katnal1	T	C	5: 148,904,676	D126G	probably benign	Het
Knl1	A	T	2: 119,068,307	K163M	probably damaging	Het
Krt17	C	T	11: 100,257,539	E359K	possibly damaging	Het
Lct	T	A	1: 128,307,822	I483F	probably damaging	Het
Loxl2	G	A	14: 69,693,040	G751D	probably damaging	Het
Ltbp4	G	A	7: 27,306,577	R1559C	possibly damaging	Het
Man2c1	T	A	9: 57,135,219	D183E	probably benign	Het
Med17	T	C	9: 15,275,843		probably null	Het
Mrgpra9	A	C	7: 47,235,813	S34R	probably benign	Het
Mrpl44	T	A	1: 79,777,960	N94K	probably damaging	Het
Nat8f1	A	G	6: 85,910,942	V12A	probably benign	Het
Nr2e3	C	A	9: 59,943,514	G354V	probably damaging	Het
Nrbp1	T	A	5: 31,245,813	I210N	probably damaging	Het
Nup155	T	C	15: 8,112,406	V94A	probably benign	Het
Olfr1497	A	T	19: 13,794,776	Y278*	probably null	Het
Olfr294	A	T	7: 86,616,361	C95S	probably damaging	Het
Olfr502	T	C	7: 108,523,318	I211V	probably benign	Het
Olfr649	C	T	7: 104,189,875	V111I	possibly damaging	Het
Pcdhb10	A	T	18: 37,412,503	I211F	possibly damaging	Het
Phip	A	C	9: 82,915,423	I509S	possibly damaging	Het
Pkhd1	C	T	1: 20,585,157		probably null	Het
Psme4	T	G	11: 30,852,744	L1487R	probably damaging	Het
Ptgdr2	A	G	19: 10,940,493	S125G	probably damaging	Het
Ptpro	A	G	6: 137,441,116	K126E	probably damaging	Het
Rdh16f2	T	A	10: 127,876,925	V264E	probably benign	Het
Ric8b	C	T	10: 84,947,671	A131V	possibly damaging	Het
Rock1	A	T	18: 10,070,233	I1280N	probably damaging	Het
Rprd2	A	G	3: 95,818,576	V59A	possibly damaging	Het
Ruvbl1	T	A	6: 88,467,569	C49S	probably benign	Het
Scn2a	A	G	2: 65,683,845	N291S	probably benign	Het
Serbp1	T	A	6: 67,277,920	H325Q	probably damaging	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Slitrk3	G	A	3: 73,050,341	T366I	probably damaging	Het
Spryd3	A	T	15: 102,118,392	H307Q	possibly damaging	Het
Spx	A	T	6: 142,418,513	D100V	probably benign	Het
Surf4	A	G	2: 26,924,464	F142L	probably damaging	Het
Syne2	T	A	12: 76,020,325		probably null	Het
Syne2	T	C	12: 76,052,178	M5278T	possibly damaging	Het
Thap12	T	C	7: 98,716,023	V466A	probably benign	Het
Thap3	T	C	4: 151,983,216	K135R	possibly damaging	Het
Tmem131	G	T	1: 36,827,358	D448E	probably benign	Het
Tmem63b	C	G	17: 45,678,978	R88P	possibly damaging	Het
Trim43a	G	T	9: 88,582,093	C19F	probably damaging	Het
Trp63	C	T	16: 25,889,120	P526L	possibly damaging	Het
Ubqln3	T	C	7: 104,142,790	D31G	probably damaging	Het
Utp14b	C	A	1: 78,665,445	N353K	probably damaging	Het
Vmn1r40	A	G	6: 89,714,576	K125R	probably damaging	Het
Vmn2r1	A	G	3: 64,101,313	Y471C	probably damaging	Het
Vmn2r13	A	G	5: 109,174,135	I232T	probably damaging	Het
Zfp263	A	C	16: 3,746,459	E204D	probably benign	Het
Zfp865	A	T	7: 5,029,279	K88*	probably null	Het

Other mutations in A1cf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:A1cf	APN	19	31920951	missense	possibly damaging	0.90
IGL01411:A1cf	APN	19	31911229	missense	possibly damaging	0.94
IGL01445:A1cf	APN	19	31945798	missense	probably benign	0.32
IGL02165:A1cf	APN	19	31927186	missense	possibly damaging	0.92
IGL02543:A1cf	APN	19	31918095	missense	probably damaging	0.97
IGL02651:A1cf	APN	19	31932506	missense	probably benign	0.25
IGL02904:A1cf	APN	19	31934806	missense	probably damaging	1.00
Haywire	UTSW	19	31918124	critical splice donor site	probably null
R0281:A1cf	UTSW	19	31945814	missense	probably benign	0.09
R0349:A1cf	UTSW	19	31932662	missense	possibly damaging	0.62
R0662:A1cf	UTSW	19	31920938	missense	probably benign	0.00
R0697:A1cf	UTSW	19	31911167	missense	probably damaging	1.00
R1055:A1cf	UTSW	19	31932519	missense	probably benign	0.05
R1125:A1cf	UTSW	19	31920978	missense	probably benign	0.00
R1554:A1cf	UTSW	19	31908902	missense	possibly damaging	0.66
R1616:A1cf	UTSW	19	31934775	missense	probably damaging	0.98
R1660:A1cf	UTSW	19	31893107	nonsense	probably null
R1719:A1cf	UTSW	19	31927126	missense	probably damaging	1.00
R2338:A1cf	UTSW	19	31932545	missense	probably benign
R2435:A1cf	UTSW	19	31920894	missense	probably benign	0.02
R2890:A1cf	UTSW	19	31918017	missense	probably benign	0.05
R3688:A1cf	UTSW	19	31911169	missense	probably damaging	1.00
R4007:A1cf	UTSW	19	31918124	critical splice donor site	probably null
R4208:A1cf	UTSW	19	31932660	missense	probably benign	0.00
R4448:A1cf	UTSW	19	31945862	missense	probably benign
R5072:A1cf	UTSW	19	31917985	missense	probably benign	0.18
R5491:A1cf	UTSW	19	31918062	missense	possibly damaging	0.57
R5636:A1cf	UTSW	19	31944982	nonsense	probably null
R5932:A1cf	UTSW	19	31893118	missense	possibly damaging	0.68
R7066:A1cf	UTSW	19	31927114	missense	probably damaging	0.99
R7211:A1cf	UTSW	19	31927141	missense	probably benign	0.23
R7413:A1cf	UTSW	19	31918124	critical splice donor site	probably null
R7545:A1cf	UTSW	19	31934790	missense	possibly damaging	0.80
R8020:A1cf	UTSW	19	31893194	missense	probably benign	0.01
R8344:A1cf	UTSW	19	31911119	missense	possibly damaging	0.77
R8497:A1cf	UTSW	19	31945850	missense	probably benign
R8989:A1cf	UTSW	19	31927156	missense	possibly damaging	0.56
R9327:A1cf	UTSW	19	31918099	missense	probably benign	0.12
R9436:A1cf	UTSW	19	31932575	missense	probably benign
Z1176:A1cf	UTSW	19	31918017	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- ATTAGGGCGCATACTCCCACGTTG -3'
(R):5'- GCATGAGGTTTGCATCCACACTCAC -3'

Sequencing Primer
(F):5'- AGTACTTTACGTGTCAGCCG -3'
(R):5'- aaacacacacacacacacac -3'

Posted On

2014-03-14