Mutagenetix > Incidental Mutations

Incidental Mutation 'R1449:Cacna1e'

159095

Institutional Source

Beutler Lab

Gene Symbol

Cacna1e

Ensembl Gene

ENSMUSG00000004110

Gene Name

calcium channel, voltage-dependent, R type, alpha 1E subunit

Synonyms

Cchra1, alpha1E, Cav2.3

MMRRC Submission

039504-MU

Accession Numbers

Genbank: NM_009782; MGI: 106217

Is this an essential gene?

Probably non essential (E-score: 0.187) question?

Stock #

R1449 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

154390731-154884501 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 154485662 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148507 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004214] [ENSMUST00000187541] [ENSMUST00000211821]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000004214

SMART Domains

Protein: ENSMUSP00000004214
Gene: ENSMUSG00000004110

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	1	55	6.7e-10	PFAM
Pfam:Ion_trans	168	407	3.3e-56	PFAM
Pfam:PKD_channel	257	401	3.3e-7	PFAM
low complexity region	409	414	N/A	INTRINSIC
low complexity region	455	469	N/A	INTRINSIC
low complexity region	496	514	N/A	INTRINSIC
low complexity region	604	620	N/A	INTRINSIC
low complexity region	626	640	N/A	INTRINSIC
coiled coil region	793	823	N/A	INTRINSIC
Pfam:Ion_trans	847	1128	2.3e-63	PFAM
Pfam:Ion_trans	1172	1429	2.6e-65	PFAM
Pfam:PKD_channel	1256	1424	2.8e-10	PFAM
Pfam:GPHH	1431	1500	1.3e-37	PFAM
Ca_chan_IQ	1555	1589	5.93e-13	SMART
low complexity region	1701	1717	N/A	INTRINSIC
low complexity region	1729	1742	N/A	INTRINSIC
low complexity region	1764	1780	N/A	INTRINSIC
low complexity region	1789	1804	N/A	INTRINSIC
low complexity region	1808	1822	N/A	INTRINSIC
low complexity region	1832	1846	N/A	INTRINSIC
low complexity region	1867	1878	N/A	INTRINSIC
low complexity region	1936	1946	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000187541

SMART Domains

Protein: ENSMUSP00000140937
Gene: ENSMUSG00000004110

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	351	8.5e-54	PFAM
PDB:4DEX\|B	354	462	6e-36	PDB
Pfam:Ion_trans	511	703	2.2e-46	PFAM
Pfam:PKD_channel	565	710	1.4e-6	PFAM
low complexity region	717	722	N/A	INTRINSIC
low complexity region	763	777	N/A	INTRINSIC
low complexity region	804	822	N/A	INTRINSIC
low complexity region	912	928	N/A	INTRINSIC
low complexity region	934	948	N/A	INTRINSIC
coiled coil region	1101	1131	N/A	INTRINSIC
low complexity region	1162	1175	N/A	INTRINSIC
Pfam:Ion_trans	1191	1425	4.3e-55	PFAM
Pfam:Ion_trans	1515	1725	5.3e-60	PFAM
Pfam:PKD_channel	1565	1732	4.7e-10	PFAM
Ca_chan_IQ	1863	1897	5.93e-13	SMART
low complexity region	2009	2025	N/A	INTRINSIC
low complexity region	2037	2050	N/A	INTRINSIC
low complexity region	2072	2088	N/A	INTRINSIC
low complexity region	2097	2112	N/A	INTRINSIC
low complexity region	2116	2130	N/A	INTRINSIC
low complexity region	2140	2154	N/A	INTRINSIC
low complexity region	2175	2186	N/A	INTRINSIC
low complexity region	2244	2254	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188965

Predicted Effect

probably null
Transcript: ENSMUST00000211821

Coding Region Coverage

1x: 98.8%
3x: 97.9%
10x: 94.7%
20x: 87.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes. Voltage-dependent calcium channels are multi-subunit complexes, comprised of alpha-1, alpha-2, beta and delta subunits in a 1:1:1:1 ratio. The isoform alpha-1E gives rise to R-type calcium currents and belongs to the high-voltage activated group. Calcium channels containing the alpha-1E subunit may be involved in the modulation of neuronal firing patterns, an important component of information processing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered R-type Ca2+ channels, increased timidity and body weight, impaired glucose tolerance, reduced locomotor activity, and lack of the cocaine stimulation of locomotor response. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(3) Gene trapped(1)

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	A	G	4: 137,455,355	N274D	possibly damaging	Het
6430571L13Rik	T	A	9: 107,342,490	N47K	probably damaging	Het
Aasdh	C	T	5: 76,886,289	A472T	probably benign	Het
Abca13	A	G	11: 9,298,580	T2776A	probably damaging	Het
Adamts10	T	A	17: 33,545,639	V711D	probably damaging	Het
Adrb3	G	A	8: 27,227,387	R345C	probably damaging	Het
Ak7	T	C	12: 105,742,261	V325A	possibly damaging	Het
Armc6	G	A	8: 70,225,293	L129F	probably benign	Het
Bend6	T	C	1: 33,878,343	N10S	probably benign	Het
Bmpr1b	T	C	3: 141,871,373	E59G	possibly damaging	Het
Brd3	A	G	2: 27,450,251		probably null	Het
Brd3	A	G	2: 27,457,016	Y369H	probably damaging	Het
Camk4	A	G	18: 32,939,475	D27G	probably damaging	Het
Camkk1	T	G	11: 73,033,884	S308A	probably damaging	Het
Catsperb	A	G	12: 101,588,197	T717A	probably benign	Het
Cdh23	A	T	10: 60,376,951	S1563R	probably damaging	Het
Cep44	A	T	8: 56,540,950	S197R	probably benign	Het
Col3a1	T	A	1: 45,321,611	I67N	unknown	Het
Dcaf12l1	T	C	X: 44,789,427	T165A	probably benign	Het
Dicer1	T	C	12: 104,729,243	Y143C	possibly damaging	Het
Dlg5	A	G	14: 24,135,643	I1898T	possibly damaging	Het
Dnah1	T	C	14: 31,263,951	N3762D	probably damaging	Het
Dscaml1	A	T	9: 45,742,223	T1382S	possibly damaging	Het
Entpd3	A	T	9: 120,566,489	R513W	probably damaging	Het
Foxred1	A	G	9: 35,209,442	S132P	probably damaging	Het
Ftsj3	T	C	11: 106,253,000	I273V	probably benign	Het
Hsd17b7	C	T	1: 169,959,682		probably null	Het
Iars	T	A	13: 49,733,710	V1253D	probably damaging	Het
Iqsec1	T	A	6: 90,690,808	K216*	probably null	Het
Itga7	A	G	10: 128,953,501	D971G	probably benign	Het
Kcnk2	G	A	1: 189,340,026	S35L	probably benign	Het
Kif13a	T	C	13: 46,812,736	Y402C	probably damaging	Het
Lamc1	A	G	1: 153,250,495	S484P	probably benign	Het
Lap3	T	C	5: 45,509,519		probably null	Het
Lhx8	G	T	3: 154,328,105	S46*	probably null	Het
Lin7a	T	C	10: 107,323,952	S42P	probably damaging	Het
Lrba	G	A	3: 86,354,278	R1513Q	probably damaging	Het
Maml2	C	A	9: 13,620,684	P398Q	possibly damaging	Het
Mast2	T	C	4: 116,309,013	I1201V	probably damaging	Het
Mmp20	A	T	9: 7,642,768	D201V	probably damaging	Het
Morn5	T	A	2: 36,057,080	C123*	probably null	Het
Mrpl4	A	G	9: 21,007,511	K175E	possibly damaging	Het
Nav3	A	T	10: 109,853,511	S302T	probably benign	Het
Ndrg2	T	C	14: 51,908,134	Y217C	probably damaging	Het
Nfx1	A	G	4: 40,976,803	D159G	probably damaging	Het
Nlrp9b	A	T	7: 20,023,164	T109S	possibly damaging	Het
Npepps	A	G	11: 97,207,154	Y909H	probably benign	Het
Olfr1510	A	G	14: 52,410,567	C102R	probably damaging	Het
Olfr559	A	T	7: 102,724,190	F100Y	probably damaging	Het
Olfr740	A	G	14: 50,453,921	N290D	probably damaging	Het
Olfr801	T	A	10: 129,670,369	D50V	probably damaging	Het
Olfr810	A	C	10: 129,790,854	V245G	probably damaging	Het
Pcdh1	T	C	18: 38,189,876	H968R	probably damaging	Het
Pde1b	T	A	15: 103,525,043	I296N	probably damaging	Het
Phldb1	T	A	9: 44,716,633	T172S	probably benign	Het
Plxdc2	T	C	2: 16,660,781	V215A	possibly damaging	Het
Poln	A	G	5: 34,014,338	I695T	probably damaging	Het
Pou6f2	G	T	13: 18,172,415	Q31K	probably damaging	Het
Psd	T	A	19: 46,324,811	Y40F	probably damaging	Het
Rnf126	T	C	10: 79,761,614	N155D	probably benign	Het
Rpl36-ps3	C	A	12: 12,912,031		noncoding transcript	Het
Rrp15	C	A	1: 186,736,268	V184F	possibly damaging	Het
Rslcan18	G	T	13: 67,102,100	L24M	possibly damaging	Het
Sall1	A	G	8: 89,032,483	I331T	probably benign	Het
Slamf7	A	T	1: 171,641,038	N95K	possibly damaging	Het
Slc1a6	T	C	10: 78,800,117	Y339H	probably damaging	Het
Slc39a8	A	G	3: 135,826,685	N72D	probably benign	Het
Slf1	A	G	13: 77,083,449	S604P	probably damaging	Het
Slfn4	C	T	11: 83,188,993	T110M	probably benign	Het
Tnpo1	T	C	13: 98,878,712	T116A	probably damaging	Het
Tor1b	T	C	2: 30,955,881	I190T	probably damaging	Het
Ttn	C	A	2: 76,969,794	E357*	probably null	Het
Tubg2	G	T	11: 101,156,873	E95*	probably null	Het
Ubap2	A	G	4: 41,209,351		probably null	Het
Ube2i	T	C	17: 25,268,564	D67G	possibly damaging	Het
Ubxn11	A	G	4: 134,124,892	E50G	probably damaging	Het
Wnk1	A	G	6: 119,952,818	V1246A	probably damaging	Het
Zcchc7	A	G	4: 44,929,124	T38A	possibly damaging	Het
Zfp236	A	G	18: 82,646,005	S552P	probably damaging	Het

Other mutations in Cacna1e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Cacna1e	APN	1	154403683	missense	probably damaging	0.99
IGL01086:Cacna1e	APN	1	154471601	missense	probably benign	0.04
IGL01302:Cacna1e	APN	1	154443907	missense	probably damaging	1.00
IGL01386:Cacna1e	APN	1	154472377	missense	probably benign	0.18
IGL01573:Cacna1e	APN	1	154471367	missense	probably benign
IGL01676:Cacna1e	APN	1	154398476	missense	probably damaging	1.00
IGL01676:Cacna1e	APN	1	154412450	missense	probably damaging	1.00
IGL01762:Cacna1e	APN	1	154471373	missense	possibly damaging	0.78
IGL01801:Cacna1e	APN	1	154471340	missense	probably null	0.00
IGL01895:Cacna1e	APN	1	154443900	missense	probably damaging	1.00
IGL02391:Cacna1e	APN	1	154421113	missense	probably damaging	1.00
IGL02399:Cacna1e	APN	1	154403747	missense	probably damaging	1.00
IGL02659:Cacna1e	APN	1	154426528	missense	probably damaging	1.00
IGL02686:Cacna1e	APN	1	154493409	missense	probably damaging	1.00
IGL02838:Cacna1e	APN	1	154445648	missense	probably damaging	1.00
IGL02958:Cacna1e	APN	1	154465741	missense	probably damaging	1.00
IGL02981:Cacna1e	APN	1	154471425	missense	probably benign	0.15
IGL03120:Cacna1e	APN	1	154443881	missense	probably damaging	1.00
IGL03232:Cacna1e	APN	1	154493358	missense	probably damaging	1.00
IGL03310:Cacna1e	APN	1	154442251	missense	probably damaging	1.00
IGL03342:Cacna1e	APN	1	154466944	critical splice donor site	probably null
bezoar	UTSW	1	154436554	splice site	probably null
hairball	UTSW	1	154479305	missense	probably damaging	0.97
N/A - 535:Cacna1e	UTSW	1	154465764	missense	probably damaging	1.00
R0122:Cacna1e	UTSW	1	154443901	missense	probably damaging	1.00
R0143:Cacna1e	UTSW	1	154448947	splice site	probably null
R0314:Cacna1e	UTSW	1	154442251	missense	probably damaging	1.00
R0366:Cacna1e	UTSW	1	154416138	missense	probably benign	0.03
R0626:Cacna1e	UTSW	1	154488817	missense	probably damaging	0.99
R0739:Cacna1e	UTSW	1	154442278	missense	probably damaging	0.97
R1272:Cacna1e	UTSW	1	154444968	missense	probably damaging	1.00
R1300:Cacna1e	UTSW	1	154398673	missense	probably benign
R1340:Cacna1e	UTSW	1	154472657	missense	probably damaging	1.00
R1440:Cacna1e	UTSW	1	154561806	missense	possibly damaging	0.63
R1538:Cacna1e	UTSW	1	154561758	missense	probably damaging	0.99
R1542:Cacna1e	UTSW	1	154477779	missense	probably benign	0.01
R1560:Cacna1e	UTSW	1	154421104	nonsense	probably null
R1748:Cacna1e	UTSW	1	154486569	missense	possibly damaging	0.92
R1749:Cacna1e	UTSW	1	154444000	missense	probably damaging	1.00
R1912:Cacna1e	UTSW	1	154436449	missense	probably damaging	1.00
R1968:Cacna1e	UTSW	1	154700494	missense	probably damaging	1.00
R1993:Cacna1e	UTSW	1	154477817	missense	probably damaging	0.97
R1994:Cacna1e	UTSW	1	154477817	missense	probably damaging	0.97
R2191:Cacna1e	UTSW	1	154443845	missense	probably damaging	1.00
R2291:Cacna1e	UTSW	1	154403683	missense	probably damaging	0.99
R2417:Cacna1e	UTSW	1	154472193	missense	probably damaging	1.00
R3608:Cacna1e	UTSW	1	154416085	missense	probably benign	0.08
R3757:Cacna1e	UTSW	1	154633696	missense	probably damaging	0.97
R3890:Cacna1e	UTSW	1	154483553	missense	probably damaging	1.00
R4015:Cacna1e	UTSW	1	154482585	missense	probably damaging	1.00
R4088:Cacna1e	UTSW	1	154412183	splice site	probably null
R4275:Cacna1e	UTSW	1	154493325	missense	probably damaging	1.00
R4282:Cacna1e	UTSW	1	154426550	missense	probably benign	0.04
R4297:Cacna1e	UTSW	1	154398731	missense	probably benign	0.37
R4356:Cacna1e	UTSW	1	154443981	missense	probably damaging	1.00
R4510:Cacna1e	UTSW	1	154561833	missense	probably damaging	1.00
R4511:Cacna1e	UTSW	1	154561833	missense	probably damaging	1.00
R4577:Cacna1e	UTSW	1	154402027	missense	possibly damaging	0.92
R4590:Cacna1e	UTSW	1	154436519	missense	possibly damaging	0.87
R4601:Cacna1e	UTSW	1	154471613	missense	probably benign
R4622:Cacna1e	UTSW	1	154471565	missense	possibly damaging	0.81
R4626:Cacna1e	UTSW	1	154482548	splice site	probably null
R4694:Cacna1e	UTSW	1	154437266	critical splice donor site	probably null
R4727:Cacna1e	UTSW	1	154436468	nonsense	probably null
R4839:Cacna1e	UTSW	1	154421058	missense	probably damaging	1.00
R4851:Cacna1e	UTSW	1	154436554	splice site	probably null
R4894:Cacna1e	UTSW	1	154488805	nonsense	probably null
R4934:Cacna1e	UTSW	1	154481634	nonsense	probably null
R4979:Cacna1e	UTSW	1	154413993	missense	probably damaging	1.00
R5077:Cacna1e	UTSW	1	154561729	critical splice donor site	probably null
R5128:Cacna1e	UTSW	1	154402021	missense	probably damaging	0.98
R5214:Cacna1e	UTSW	1	154701364	missense	possibly damaging	0.93
R5274:Cacna1e	UTSW	1	154700504	missense	probably damaging	0.98
R5388:Cacna1e	UTSW	1	154477796	missense	probably damaging	1.00
R5416:Cacna1e	UTSW	1	154465779	missense	probably damaging	1.00
R5469:Cacna1e	UTSW	1	154443937	missense	probably damaging	1.00
R5475:Cacna1e	UTSW	1	154725709	missense	possibly damaging	0.53
R5607:Cacna1e	UTSW	1	154471340	missense	probably benign	0.00
R5615:Cacna1e	UTSW	1	154412170	missense	probably damaging	1.00
R5616:Cacna1e	UTSW	1	154442194	missense	probably damaging	1.00
R5627:Cacna1e	UTSW	1	154635858	missense	probably damaging	0.98
R5707:Cacna1e	UTSW	1	154633717	missense	probably damaging	1.00
R5756:Cacna1e	UTSW	1	154471637	missense	probably benign	0.00
R5893:Cacna1e	UTSW	1	154437323	missense	probably damaging	1.00
R6117:Cacna1e	UTSW	1	154561791	missense	possibly damaging	0.68
R6134:Cacna1e	UTSW	1	154701291	missense	probably damaging	1.00
R6190:Cacna1e	UTSW	1	154486570	missense	possibly damaging	0.47
R6279:Cacna1e	UTSW	1	154425932	missense	probably benign	0.38
R6295:Cacna1e	UTSW	1	154442173	missense	probably damaging	0.98
R6300:Cacna1e	UTSW	1	154425932	missense	probably benign	0.38
R6320:Cacna1e	UTSW	1	154441524	missense	possibly damaging	0.76
R6375:Cacna1e	UTSW	1	154479305	missense	probably damaging	0.97
R6830:Cacna1e	UTSW	1	154413974	critical splice donor site	probably null
R6842:Cacna1e	UTSW	1	154483117	missense	probably damaging	1.00
R7023:Cacna1e	UTSW	1	154725693	missense	probably null	0.85
R7081:Cacna1e	UTSW	1	154700383	missense	possibly damaging	0.82
R7085:Cacna1e	UTSW	1	154473746	splice site	probably null
R7108:Cacna1e	UTSW	1	154468995	frame shift	probably null
R7142:Cacna1e	UTSW	1	154412484	missense	probably damaging	1.00
R7250:Cacna1e	UTSW	1	154700489	missense	possibly damaging	0.93
R7332:Cacna1e	UTSW	1	154725801	missense	possibly damaging	0.89
R7410:Cacna1e	UTSW	1	154472234	missense	probably benign	0.13
R7502:Cacna1e	UTSW	1	154468988	missense	probably null	0.35
R7556:Cacna1e	UTSW	1	154472673	missense	probably benign	0.28
R7563:Cacna1e	UTSW	1	154471416	missense	probably benign	0.00
R7573:Cacna1e	UTSW	1	154726165	intron	probably benign
R7689:Cacna1e	UTSW	1	154398803	missense	probably benign	0.01
R7699:Cacna1e	UTSW	1	154443928	missense	probably damaging	1.00
R7744:Cacna1e	UTSW	1	154465792	missense	probably damaging	1.00
R7754:Cacna1e	UTSW	1	154413117	missense	probably damaging	0.97
R7787:Cacna1e	UTSW	1	154482568	missense	probably damaging	0.98
R7818:Cacna1e	UTSW	1	154398406	missense	probably damaging	1.00
R7838:Cacna1e	UTSW	1	154471403	missense	probably benign	0.08
R7849:Cacna1e	UTSW	1	154633718	missense	probably damaging	1.00
R8011:Cacna1e	UTSW	1	154465822	missense	probably benign	0.01
R8094:Cacna1e	UTSW	1	154561770	missense	probably damaging	1.00
R8162:Cacna1e	UTSW	1	154701567	splice site	probably null
R8202:Cacna1e	UTSW	1	154398449	missense	probably benign
R8280:Cacna1e	UTSW	1	154469093	missense	probably damaging	0.97
R8354:Cacna1e	UTSW	1	154398568	missense	probably damaging	1.00
R8385:Cacna1e	UTSW	1	154443941	missense	probably damaging	0.98
R8532:Cacna1e	UTSW	1	154465764	missense	probably damaging	1.00
R8902:Cacna1e	UTSW	1	154473886	missense	probably benign	0.01
R8926:Cacna1e	UTSW	1	154701334	missense	possibly damaging	0.84
R8947:Cacna1e	UTSW	1	154402150	missense	probably benign	0.10
R9094:Cacna1e	UTSW	1	154479318	missense	possibly damaging	0.93
R9126:Cacna1e	UTSW	1	154467764	missense	probably benign	0.01
R9175:Cacna1e	UTSW	1	154398568	missense	probably damaging	1.00
R9286:Cacna1e	UTSW	1	154413099	missense	probably damaging	1.00
R9377:Cacna1e	UTSW	1	154485712	missense	possibly damaging	0.88
RF008:Cacna1e	UTSW	1	154442136	missense	probably damaging	1.00
X0062:Cacna1e	UTSW	1	154412492	missense	probably damaging	1.00
Z1176:Cacna1e	UTSW	1	154635850	missense	probably damaging	0.98
Z1177:Cacna1e	UTSW	1	154442292	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAAGGATTCGCTGGCTTCTGAAC -3'
(R):5'- GCTCCTGTCACTAAAGGGCAACTG -3'

Sequencing Primer
(F):5'- GGCTTCTGAACTGCCTTTTC -3'
(R):5'- CTTACATTCTGAAATCTGGGGC -3'

Posted On

2014-03-14