Incidental Mutation 'R1449:Slc39a8'
ID 159108
Institutional Source Beutler Lab
Gene Symbol Slc39a8
Ensembl Gene ENSMUSG00000053897
Gene Name solute carrier family 39 (metal ion transporter), member 8
Synonyms 4933419D20Rik, BIGM103, ZIP8
MMRRC Submission 039504-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1449 (G1)
Quality Score 215
Status Not validated
Chromosome 3
Chromosomal Location 135825279-135888572 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 135826685 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 72 (N72D)
Ref Sequence ENSEMBL: ENSMUSP00000136634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029810] [ENSMUST00000081978] [ENSMUST00000167390] [ENSMUST00000180196]
AlphaFold Q91W10
Predicted Effect probably benign
Transcript: ENSMUST00000029810
AA Change: N72D

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029810
Gene: ENSMUSG00000053897
AA Change: N72D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Zip 126 453 6.2e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081978
AA Change: N72D

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080640
Gene: ENSMUSG00000053897
AA Change: N72D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Zip 126 453 4.7e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139953
Predicted Effect probably benign
Transcript: ENSMUST00000167390
AA Change: N72D

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128245
Gene: ENSMUSG00000053897
AA Change: N72D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Zip 126 453 4.7e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180196
AA Change: N72D

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136634
Gene: ENSMUSG00000053897
AA Change: N72D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Zip 126 453 4.7e-72 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC39 family of solute-carrier genes, which show structural characteristics of zinc transporters. The encoded protein is glycosylated and found in the plasma membrane and mitochondria, and functions in the cellular import of zinc at the onset of inflammation. It is also thought to be the primary transporter of the toxic cation cadmium, which is found in cigarette smoke. Multiple transcript variants encoding different isoforms have been found for this gene. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A G 4: 137,455,355 N274D possibly damaging Het
6430571L13Rik T A 9: 107,342,490 N47K probably damaging Het
Aasdh C T 5: 76,886,289 A472T probably benign Het
Abca13 A G 11: 9,298,580 T2776A probably damaging Het
Adamts10 T A 17: 33,545,639 V711D probably damaging Het
Adrb3 G A 8: 27,227,387 R345C probably damaging Het
Ak7 T C 12: 105,742,261 V325A possibly damaging Het
Armc6 G A 8: 70,225,293 L129F probably benign Het
Bend6 T C 1: 33,878,343 N10S probably benign Het
Bmpr1b T C 3: 141,871,373 E59G possibly damaging Het
Brd3 A G 2: 27,450,251 probably null Het
Brd3 A G 2: 27,457,016 Y369H probably damaging Het
Cacna1e C T 1: 154,485,662 probably null Het
Camk4 A G 18: 32,939,475 D27G probably damaging Het
Camkk1 T G 11: 73,033,884 S308A probably damaging Het
Catsperb A G 12: 101,588,197 T717A probably benign Het
Cdh23 A T 10: 60,376,951 S1563R probably damaging Het
Cep44 A T 8: 56,540,950 S197R probably benign Het
Col3a1 T A 1: 45,321,611 I67N unknown Het
Dcaf12l1 T C X: 44,789,427 T165A probably benign Het
Dicer1 T C 12: 104,729,243 Y143C possibly damaging Het
Dlg5 A G 14: 24,135,643 I1898T possibly damaging Het
Dnah1 T C 14: 31,263,951 N3762D probably damaging Het
Dscaml1 A T 9: 45,742,223 T1382S possibly damaging Het
Entpd3 A T 9: 120,566,489 R513W probably damaging Het
Foxred1 A G 9: 35,209,442 S132P probably damaging Het
Ftsj3 T C 11: 106,253,000 I273V probably benign Het
Hsd17b7 C T 1: 169,959,682 probably null Het
Iars T A 13: 49,733,710 V1253D probably damaging Het
Iqsec1 T A 6: 90,690,808 K216* probably null Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Kcnk2 G A 1: 189,340,026 S35L probably benign Het
Kif13a T C 13: 46,812,736 Y402C probably damaging Het
Lamc1 A G 1: 153,250,495 S484P probably benign Het
Lap3 T C 5: 45,509,519 probably null Het
Lhx8 G T 3: 154,328,105 S46* probably null Het
Lin7a T C 10: 107,323,952 S42P probably damaging Het
Lrba G A 3: 86,354,278 R1513Q probably damaging Het
Maml2 C A 9: 13,620,684 P398Q possibly damaging Het
Mast2 T C 4: 116,309,013 I1201V probably damaging Het
Mmp20 A T 9: 7,642,768 D201V probably damaging Het
Morn5 T A 2: 36,057,080 C123* probably null Het
Mrpl4 A G 9: 21,007,511 K175E possibly damaging Het
Nav3 A T 10: 109,853,511 S302T probably benign Het
Ndrg2 T C 14: 51,908,134 Y217C probably damaging Het
Nfx1 A G 4: 40,976,803 D159G probably damaging Het
Nlrp9b A T 7: 20,023,164 T109S possibly damaging Het
Npepps A G 11: 97,207,154 Y909H probably benign Het
Olfr1510 A G 14: 52,410,567 C102R probably damaging Het
Olfr559 A T 7: 102,724,190 F100Y probably damaging Het
Olfr740 A G 14: 50,453,921 N290D probably damaging Het
Olfr801 T A 10: 129,670,369 D50V probably damaging Het
Olfr810 A C 10: 129,790,854 V245G probably damaging Het
Pcdh1 T C 18: 38,189,876 H968R probably damaging Het
Pde1b T A 15: 103,525,043 I296N probably damaging Het
Phldb1 T A 9: 44,716,633 T172S probably benign Het
Plxdc2 T C 2: 16,660,781 V215A possibly damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
Pou6f2 G T 13: 18,172,415 Q31K probably damaging Het
Psd T A 19: 46,324,811 Y40F probably damaging Het
Rnf126 T C 10: 79,761,614 N155D probably benign Het
Rpl36-ps3 C A 12: 12,912,031 noncoding transcript Het
Rrp15 C A 1: 186,736,268 V184F possibly damaging Het
Rslcan18 G T 13: 67,102,100 L24M possibly damaging Het
Sall1 A G 8: 89,032,483 I331T probably benign Het
Slamf7 A T 1: 171,641,038 N95K possibly damaging Het
Slc1a6 T C 10: 78,800,117 Y339H probably damaging Het
Slf1 A G 13: 77,083,449 S604P probably damaging Het
Slfn4 C T 11: 83,188,993 T110M probably benign Het
Tnpo1 T C 13: 98,878,712 T116A probably damaging Het
Tor1b T C 2: 30,955,881 I190T probably damaging Het
Ttn C A 2: 76,969,794 E357* probably null Het
Tubg2 G T 11: 101,156,873 E95* probably null Het
Ubap2 A G 4: 41,209,351 probably null Het
Ube2i T C 17: 25,268,564 D67G possibly damaging Het
Ubxn11 A G 4: 134,124,892 E50G probably damaging Het
Wnk1 A G 6: 119,952,818 V1246A probably damaging Het
Zcchc7 A G 4: 44,929,124 T38A possibly damaging Het
Zfp236 A G 18: 82,646,005 S552P probably damaging Het
Other mutations in Slc39a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Slc39a8 APN 3 135858112 missense probably benign
IGL00793:Slc39a8 APN 3 135884733 missense probably benign 0.00
IGL02591:Slc39a8 APN 3 135884620 missense probably damaging 1.00
IGL02868:Slc39a8 APN 3 135856026 missense probably damaging 1.00
IGL03062:Slc39a8 APN 3 135886797 splice site probably benign
IGL03144:Slc39a8 APN 3 135884210 missense probably benign 0.01
IGL03329:Slc39a8 APN 3 135884713 missense probably damaging 0.98
R2869:Slc39a8 UTSW 3 135886793 splice site probably null
R2869:Slc39a8 UTSW 3 135886793 splice site probably null
R2870:Slc39a8 UTSW 3 135886793 splice site probably null
R2870:Slc39a8 UTSW 3 135886793 splice site probably null
R2871:Slc39a8 UTSW 3 135886793 splice site probably null
R2871:Slc39a8 UTSW 3 135886793 splice site probably null
R2872:Slc39a8 UTSW 3 135886793 splice site probably null
R2872:Slc39a8 UTSW 3 135886793 splice site probably null
R2873:Slc39a8 UTSW 3 135886793 splice site probably null
R2937:Slc39a8 UTSW 3 135886823 missense probably benign 0.00
R3832:Slc39a8 UTSW 3 135849133 missense probably damaging 0.96
R4669:Slc39a8 UTSW 3 135856011 missense probably benign 0.35
R5057:Slc39a8 UTSW 3 135849029 missense probably benign 0.00
R5098:Slc39a8 UTSW 3 135858157 missense probably benign 0.01
R5677:Slc39a8 UTSW 3 135884688 missense probably damaging 1.00
R6747:Slc39a8 UTSW 3 135849180 critical splice donor site probably null
R7181:Slc39a8 UTSW 3 135857538 missense possibly damaging 0.93
R7459:Slc39a8 UTSW 3 135886911 missense probably damaging 1.00
R7506:Slc39a8 UTSW 3 135884306 missense probably benign 0.03
R7589:Slc39a8 UTSW 3 135884362 missense probably damaging 0.96
R7860:Slc39a8 UTSW 3 135884396 missense probably damaging 1.00
R8059:Slc39a8 UTSW 3 135826586 missense probably benign 0.00
R8096:Slc39a8 UTSW 3 135884656 missense probably damaging 1.00
R8144:Slc39a8 UTSW 3 135884643 nonsense probably null
R8218:Slc39a8 UTSW 3 135857564 missense probably benign 0.03
R9431:Slc39a8 UTSW 3 135858162 missense probably benign 0.03
X0023:Slc39a8 UTSW 3 135826544 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACCTCTTCAATGCCCCGAAGGTC -3'
(R):5'- AAGTCCCTTAATGCCCGGTGAAC -3'

Sequencing Primer
(F):5'- ACGGAGTGTCTCGCTAACTG -3'
(R):5'- TGCCCGGTGAACCAACC -3'
Posted On 2014-03-14