Mutagenetix > Incidental Mutation

Incidental Mutation 'R1449:Nfx1'

159111

Institutional Source

Beutler Lab

Gene Symbol

Nfx1

Ensembl Gene

ENSMUSG00000028423

Gene Name

nuclear transcription factor, X-box binding 1

Synonyms

1300017N15Rik, Tex42, 3000003M19Rik, TEG-42

MMRRC Submission

039504-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.447) question?

Stock #

R1449 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

40970906-41025993 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 40976803 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 159 (D159G)

Ref Sequence

ENSEMBL: ENSMUSP00000095747 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030133] [ENSMUST00000091614] [ENSMUST00000098143]

AlphaFold

B1AY10

Predicted Effect

probably damaging
Transcript: ENSMUST00000030133
AA Change: D159G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000030133
Gene: ENSMUSG00000028423
AA Change: D159G

Domain	Start	End	E-Value	Type
RING	352	402	3.91e-2	SMART
ZnF_NFX	447	465	1.23e-3	SMART
ZnF_NFX	500	519	6.16e-4	SMART
ZnF_NFX	561	580	2e-3	SMART
ZnF_NFX	626	649	5.45e-5	SMART
ZnF_NFX	688	707	5.25e0	SMART
ZnF_NFX	715	734	2.92e-5	SMART
ZnF_NFX	772	791	5.25e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000091614
AA Change: D159G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000089203
Gene: ENSMUSG00000028423
AA Change: D159G

Domain	Start	End	E-Value	Type
RING	352	402	3.91e-2	SMART
ZnF_NFX	447	465	1.23e-3	SMART
ZnF_NFX	500	519	6.16e-4	SMART
ZnF_NFX	561	580	2e-3	SMART
ZnF_NFX	626	649	5.45e-5	SMART
ZnF_NFX	688	707	5.25e0	SMART
ZnF_NFX	715	734	2.92e-5	SMART
ZnF_NFX	772	791	5.25e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000098143
AA Change: D159G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000095747
Gene: ENSMUSG00000028423
AA Change: D159G

Domain	Start	End	E-Value	Type
RING	352	402	3.91e-2	SMART
ZnF_NFX	447	465	1.23e-3	SMART
ZnF_NFX	500	519	6.16e-4	SMART
ZnF_NFX	561	580	2e-3	SMART
ZnF_NFX	626	649	5.45e-5	SMART
ZnF_NFX	688	707	5.25e0	SMART
ZnF_NFX	715	734	2.92e-5	SMART
ZnF_NFX	772	791	5.25e0	SMART
ZnF_NFX	826	848	7.7e-5	SMART
ZnF_NFX	857	878	4.23e-2	SMART
coiled coil region	930	956	N/A	INTRINSIC
R3H	977	1055	1.38e-22	SMART
low complexity region	1070	1088	N/A	INTRINSIC

Meta Mutation Damage Score

0.1213

Coding Region Coverage

1x: 98.8%
3x: 97.9%
10x: 94.7%
20x: 87.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MHC class II gene expression is controlled primarily at the transcriptional level by transcription factors that bind to the X and Y boxes, two highly conserved elements in the proximal promoter of MHC class II genes. The protein encoded by this gene is a transcriptional repressor capable of binding to the conserved X box motif of HLA-DRA and other MHC class II genes in vitro. The protein may play a role in regulating the duration of an inflammatory response by limiting the period in which class II MHC molecules are induced by IFN-gamma. Three alternative splice variants, each of which encodes a different isoform, have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	A	G	4: 137,455,355	N274D	possibly damaging	Het
6430571L13Rik	T	A	9: 107,342,490	N47K	probably damaging	Het
Aasdh	C	T	5: 76,886,289	A472T	probably benign	Het
Abca13	A	G	11: 9,298,580	T2776A	probably damaging	Het
Adamts10	T	A	17: 33,545,639	V711D	probably damaging	Het
Adrb3	G	A	8: 27,227,387	R345C	probably damaging	Het
Ak7	T	C	12: 105,742,261	V325A	possibly damaging	Het
Armc6	G	A	8: 70,225,293	L129F	probably benign	Het
Bend6	T	C	1: 33,878,343	N10S	probably benign	Het
Bmpr1b	T	C	3: 141,871,373	E59G	possibly damaging	Het
Brd3	A	G	2: 27,450,251		probably null	Het
Brd3	A	G	2: 27,457,016	Y369H	probably damaging	Het
Cacna1e	C	T	1: 154,485,662		probably null	Het
Camk4	A	G	18: 32,939,475	D27G	probably damaging	Het
Camkk1	T	G	11: 73,033,884	S308A	probably damaging	Het
Catsperb	A	G	12: 101,588,197	T717A	probably benign	Het
Cdh23	A	T	10: 60,376,951	S1563R	probably damaging	Het
Cep44	A	T	8: 56,540,950	S197R	probably benign	Het
Col3a1	T	A	1: 45,321,611	I67N	unknown	Het
Dcaf12l1	T	C	X: 44,789,427	T165A	probably benign	Het
Dicer1	T	C	12: 104,729,243	Y143C	possibly damaging	Het
Dlg5	A	G	14: 24,135,643	I1898T	possibly damaging	Het
Dnah1	T	C	14: 31,263,951	N3762D	probably damaging	Het
Dscaml1	A	T	9: 45,742,223	T1382S	possibly damaging	Het
Entpd3	A	T	9: 120,566,489	R513W	probably damaging	Het
Foxred1	A	G	9: 35,209,442	S132P	probably damaging	Het
Ftsj3	T	C	11: 106,253,000	I273V	probably benign	Het
Hsd17b7	C	T	1: 169,959,682		probably null	Het
Iars	T	A	13: 49,733,710	V1253D	probably damaging	Het
Iqsec1	T	A	6: 90,690,808	K216*	probably null	Het
Itga7	A	G	10: 128,953,501	D971G	probably benign	Het
Kcnk2	G	A	1: 189,340,026	S35L	probably benign	Het
Kif13a	T	C	13: 46,812,736	Y402C	probably damaging	Het
Lamc1	A	G	1: 153,250,495	S484P	probably benign	Het
Lap3	T	C	5: 45,509,519		probably null	Het
Lhx8	G	T	3: 154,328,105	S46*	probably null	Het
Lin7a	T	C	10: 107,323,952	S42P	probably damaging	Het
Lrba	G	A	3: 86,354,278	R1513Q	probably damaging	Het
Maml2	C	A	9: 13,620,684	P398Q	possibly damaging	Het
Mast2	T	C	4: 116,309,013	I1201V	probably damaging	Het
Mmp20	A	T	9: 7,642,768	D201V	probably damaging	Het
Morn5	T	A	2: 36,057,080	C123*	probably null	Het
Mrpl4	A	G	9: 21,007,511	K175E	possibly damaging	Het
Nav3	A	T	10: 109,853,511	S302T	probably benign	Het
Ndrg2	T	C	14: 51,908,134	Y217C	probably damaging	Het
Nlrp9b	A	T	7: 20,023,164	T109S	possibly damaging	Het
Npepps	A	G	11: 97,207,154	Y909H	probably benign	Het
Olfr1510	A	G	14: 52,410,567	C102R	probably damaging	Het
Olfr559	A	T	7: 102,724,190	F100Y	probably damaging	Het
Olfr740	A	G	14: 50,453,921	N290D	probably damaging	Het
Olfr801	T	A	10: 129,670,369	D50V	probably damaging	Het
Olfr810	A	C	10: 129,790,854	V245G	probably damaging	Het
Pcdh1	T	C	18: 38,189,876	H968R	probably damaging	Het
Pde1b	T	A	15: 103,525,043	I296N	probably damaging	Het
Phldb1	T	A	9: 44,716,633	T172S	probably benign	Het
Plxdc2	T	C	2: 16,660,781	V215A	possibly damaging	Het
Poln	A	G	5: 34,014,338	I695T	probably damaging	Het
Pou6f2	G	T	13: 18,172,415	Q31K	probably damaging	Het
Psd	T	A	19: 46,324,811	Y40F	probably damaging	Het
Rnf126	T	C	10: 79,761,614	N155D	probably benign	Het
Rpl36-ps3	C	A	12: 12,912,031		noncoding transcript	Het
Rrp15	C	A	1: 186,736,268	V184F	possibly damaging	Het
Rslcan18	G	T	13: 67,102,100	L24M	possibly damaging	Het
Sall1	A	G	8: 89,032,483	I331T	probably benign	Het
Slamf7	A	T	1: 171,641,038	N95K	possibly damaging	Het
Slc1a6	T	C	10: 78,800,117	Y339H	probably damaging	Het
Slc39a8	A	G	3: 135,826,685	N72D	probably benign	Het
Slf1	A	G	13: 77,083,449	S604P	probably damaging	Het
Slfn4	C	T	11: 83,188,993	T110M	probably benign	Het
Tnpo1	T	C	13: 98,878,712	T116A	probably damaging	Het
Tor1b	T	C	2: 30,955,881	I190T	probably damaging	Het
Ttn	C	A	2: 76,969,794	E357*	probably null	Het
Tubg2	G	T	11: 101,156,873	E95*	probably null	Het
Ubap2	A	G	4: 41,209,351		probably null	Het
Ube2i	T	C	17: 25,268,564	D67G	possibly damaging	Het
Ubxn11	A	G	4: 134,124,892	E50G	probably damaging	Het
Wnk1	A	G	6: 119,952,818	V1246A	probably damaging	Het
Zcchc7	A	G	4: 44,929,124	T38A	possibly damaging	Het
Zfp236	A	G	18: 82,646,005	S552P	probably damaging	Het

Other mutations in Nfx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01377:Nfx1	APN	4	40977241	missense	probably benign	0.00
IGL01998:Nfx1	APN	4	41004353	missense	probably damaging	1.00
IGL02072:Nfx1	APN	4	41016119	missense	probably benign
IGL02170:Nfx1	APN	4	41018019	missense	probably damaging	1.00
IGL02188:Nfx1	APN	4	40993827	missense	probably damaging	1.00
IGL02502:Nfx1	APN	4	40976345	splice site	probably benign
IGL02674:Nfx1	APN	4	40999717	critical splice donor site	probably null
IGL03007:Nfx1	APN	4	40984962	missense	probably benign	0.02
IGL03092:Nfx1	APN	4	41024851	missense	probably damaging	1.00
IGL03303:Nfx1	APN	4	41004323	splice site	probably benign
K7371:Nfx1	UTSW	4	40976803	missense	probably damaging	1.00
PIT4498001:Nfx1	UTSW	4	40977244	missense	probably benign
R0032:Nfx1	UTSW	4	41015321	missense	probably benign	0.00
R0032:Nfx1	UTSW	4	41015321	missense	probably benign	0.00
R0069:Nfx1	UTSW	4	40986688	splice site	probably benign
R1056:Nfx1	UTSW	4	41003057	missense	probably damaging	0.97
R1635:Nfx1	UTSW	4	40977004	missense	probably benign
R1636:Nfx1	UTSW	4	41016072	splice site	probably null
R1882:Nfx1	UTSW	4	41009240	missense	possibly damaging	0.55
R2089:Nfx1	UTSW	4	40977004	missense	probably benign
R2091:Nfx1	UTSW	4	40977004	missense	probably benign
R2091:Nfx1	UTSW	4	40977004	missense	probably benign
R3792:Nfx1	UTSW	4	41004357	nonsense	probably null
R3793:Nfx1	UTSW	4	41004357	nonsense	probably null
R4668:Nfx1	UTSW	4	40976367	missense	possibly damaging	0.50
R4678:Nfx1	UTSW	4	41012070	missense	probably benign	0.01
R4894:Nfx1	UTSW	4	40996877	missense	probably damaging	1.00
R4972:Nfx1	UTSW	4	40976375	missense	probably benign	0.36
R5066:Nfx1	UTSW	4	40991868	missense	probably benign
R5389:Nfx1	UTSW	4	40985000	missense	probably damaging	1.00
R5429:Nfx1	UTSW	4	41004343	missense	probably damaging	1.00
R5643:Nfx1	UTSW	4	40984973	missense	probably null	1.00
R5644:Nfx1	UTSW	4	40984973	missense	probably null	1.00
R5915:Nfx1	UTSW	4	40977285	missense	probably benign	0.02
R6286:Nfx1	UTSW	4	40986728	missense	probably damaging	1.00
R6393:Nfx1	UTSW	4	40976851	missense	possibly damaging	0.92
R7409:Nfx1	UTSW	4	41021830	missense	possibly damaging	0.64
R7523:Nfx1	UTSW	4	41016119	missense	probably benign
R7916:Nfx1	UTSW	4	40977142	missense	probably benign	0.11
R8497:Nfx1	UTSW	4	40976968	missense	possibly damaging	0.67
R8799:Nfx1	UTSW	4	41023727	missense	probably damaging	1.00
R9154:Nfx1	UTSW	4	40990845	missense	probably damaging	1.00
R9364:Nfx1	UTSW	4	41023756	missense	probably benign	0.31
R9497:Nfx1	UTSW	4	40994104	missense	probably benign	0.00
X0025:Nfx1	UTSW	4	40976422	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TGGAAGCAAACCTAAGAGTCCCCAG -3'
(R):5'- GCCCTGCATTTATATGCCGCTGAC -3'

Sequencing Primer
(F):5'- AGAGTCCCCAGGGTTTTTTC -3'
(R):5'- CTACAGGTTTTCTACAGGAGGCATC -3'

Posted On

2014-03-14