Mutagenetix > Incidental Mutations

Incidental Mutation 'R1449:Sall1'

159132

Institutional Source

Beutler Lab

Gene Symbol

Sall1

Ensembl Gene

ENSMUSG00000031665

Gene Name

spalt like transcription factor 1

Synonyms

Msal-3

MMRRC Submission

039504-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.950) question?

Stock #

R1449 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

89027235-89044162 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89032483 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 331 (I331T)

Ref Sequence

ENSEMBL: ENSMUSP00000034090 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034090]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000034090
AA Change: I331T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000034090
Gene: ENSMUSG00000031665
AA Change: I331T

Domain	Start	End	E-Value	Type
low complexity region	133	152	N/A	INTRINSIC
low complexity region	163	175	N/A	INTRINSIC
low complexity region	229	257	N/A	INTRINSIC
low complexity region	283	309	N/A	INTRINSIC
low complexity region	361	396	N/A	INTRINSIC
ZnF_C2H2	450	472	2.57e-3	SMART
ZnF_C2H2	478	500	3.21e-4	SMART
low complexity region	547	569	N/A	INTRINSIC
ZnF_C2H2	705	727	3.02e0	SMART
ZnF_C2H2	733	755	8.6e-5	SMART
ZnF_C2H2	765	787	1.6e-4	SMART
low complexity region	842	861	N/A	INTRINSIC
ZnF_C2H2	1000	1022	2.91e-2	SMART
ZnF_C2H2	1028	1050	4.94e-5	SMART
ZnF_C2H2	1133	1155	1.38e-3	SMART
ZnF_C2H2	1161	1183	1.22e-4	SMART
low complexity region	1257	1277	N/A	INTRINSIC

Coding Region Coverage

1x: 98.8%
3x: 97.9%
10x: 94.7%
20x: 87.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcriptional repressor and may be part of the NuRD histone deacetylase complex (HDAC). Defects in this gene are a cause of Townes-Brocks syndrome (TBS) as well as bronchio-oto-renal syndrome (BOR). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit kidney agenesis or dysgenesis and die perinatally. Homozygotes expressing only a truncated protein show renal agenesis, exencephaly, and limb defects; heterozygotes have hearing loss and cystic kidneys. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	A	G	4: 137,455,355	N274D	possibly damaging	Het
6430571L13Rik	T	A	9: 107,342,490	N47K	probably damaging	Het
Aasdh	C	T	5: 76,886,289	A472T	probably benign	Het
Abca13	A	G	11: 9,298,580	T2776A	probably damaging	Het
Adamts10	T	A	17: 33,545,639	V711D	probably damaging	Het
Adrb3	G	A	8: 27,227,387	R345C	probably damaging	Het
Ak7	T	C	12: 105,742,261	V325A	possibly damaging	Het
Armc6	G	A	8: 70,225,293	L129F	probably benign	Het
Bend6	T	C	1: 33,878,343	N10S	probably benign	Het
Bmpr1b	T	C	3: 141,871,373	E59G	possibly damaging	Het
Brd3	A	G	2: 27,450,251		probably null	Het
Brd3	A	G	2: 27,457,016	Y369H	probably damaging	Het
Cacna1e	C	T	1: 154,485,662		probably null	Het
Camk4	A	G	18: 32,939,475	D27G	probably damaging	Het
Camkk1	T	G	11: 73,033,884	S308A	probably damaging	Het
Catsperb	A	G	12: 101,588,197	T717A	probably benign	Het
Cdh23	A	T	10: 60,376,951	S1563R	probably damaging	Het
Cep44	A	T	8: 56,540,950	S197R	probably benign	Het
Col3a1	T	A	1: 45,321,611	I67N	unknown	Het
Dcaf12l1	T	C	X: 44,789,427	T165A	probably benign	Het
Dicer1	T	C	12: 104,729,243	Y143C	possibly damaging	Het
Dlg5	A	G	14: 24,135,643	I1898T	possibly damaging	Het
Dnah1	T	C	14: 31,263,951	N3762D	probably damaging	Het
Dscaml1	A	T	9: 45,742,223	T1382S	possibly damaging	Het
Entpd3	A	T	9: 120,566,489	R513W	probably damaging	Het
Foxred1	A	G	9: 35,209,442	S132P	probably damaging	Het
Ftsj3	T	C	11: 106,253,000	I273V	probably benign	Het
Hsd17b7	C	T	1: 169,959,682		probably null	Het
Iars	T	A	13: 49,733,710	V1253D	probably damaging	Het
Iqsec1	T	A	6: 90,690,808	K216*	probably null	Het
Itga7	A	G	10: 128,953,501	D971G	probably benign	Het
Kcnk2	G	A	1: 189,340,026	S35L	probably benign	Het
Kif13a	T	C	13: 46,812,736	Y402C	probably damaging	Het
Lamc1	A	G	1: 153,250,495	S484P	probably benign	Het
Lap3	T	C	5: 45,509,519		probably null	Het
Lhx8	G	T	3: 154,328,105	S46*	probably null	Het
Lin7a	T	C	10: 107,323,952	S42P	probably damaging	Het
Lrba	G	A	3: 86,354,278	R1513Q	probably damaging	Het
Maml2	C	A	9: 13,620,684	P398Q	possibly damaging	Het
Mast2	T	C	4: 116,309,013	I1201V	probably damaging	Het
Mmp20	A	T	9: 7,642,768	D201V	probably damaging	Het
Morn5	T	A	2: 36,057,080	C123*	probably null	Het
Mrpl4	A	G	9: 21,007,511	K175E	possibly damaging	Het
Nav3	A	T	10: 109,853,511	S302T	probably benign	Het
Ndrg2	T	C	14: 51,908,134	Y217C	probably damaging	Het
Nfx1	A	G	4: 40,976,803	D159G	probably damaging	Het
Nlrp9b	A	T	7: 20,023,164	T109S	possibly damaging	Het
Npepps	A	G	11: 97,207,154	Y909H	probably benign	Het
Olfr1510	A	G	14: 52,410,567	C102R	probably damaging	Het
Olfr559	A	T	7: 102,724,190	F100Y	probably damaging	Het
Olfr740	A	G	14: 50,453,921	N290D	probably damaging	Het
Olfr801	T	A	10: 129,670,369	D50V	probably damaging	Het
Olfr810	A	C	10: 129,790,854	V245G	probably damaging	Het
Pcdh1	T	C	18: 38,189,876	H968R	probably damaging	Het
Pde1b	T	A	15: 103,525,043	I296N	probably damaging	Het
Phldb1	T	A	9: 44,716,633	T172S	probably benign	Het
Plxdc2	T	C	2: 16,660,781	V215A	possibly damaging	Het
Poln	A	G	5: 34,014,338	I695T	probably damaging	Het
Pou6f2	G	T	13: 18,172,415	Q31K	probably damaging	Het
Psd	T	A	19: 46,324,811	Y40F	probably damaging	Het
Rnf126	T	C	10: 79,761,614	N155D	probably benign	Het
Rpl36-ps3	C	A	12: 12,912,031		noncoding transcript	Het
Rrp15	C	A	1: 186,736,268	V184F	possibly damaging	Het
Rslcan18	G	T	13: 67,102,100	L24M	possibly damaging	Het
Slamf7	A	T	1: 171,641,038	N95K	possibly damaging	Het
Slc1a6	T	C	10: 78,800,117	Y339H	probably damaging	Het
Slc39a8	A	G	3: 135,826,685	N72D	probably benign	Het
Slf1	A	G	13: 77,083,449	S604P	probably damaging	Het
Slfn4	C	T	11: 83,188,993	T110M	probably benign	Het
Tnpo1	T	C	13: 98,878,712	T116A	probably damaging	Het
Tor1b	T	C	2: 30,955,881	I190T	probably damaging	Het
Ttn	C	A	2: 76,969,794	E357*	probably null	Het
Tubg2	G	T	11: 101,156,873	E95*	probably null	Het
Ubap2	A	G	4: 41,209,351		probably null	Het
Ube2i	T	C	17: 25,268,564	D67G	possibly damaging	Het
Ubxn11	A	G	4: 134,124,892	E50G	probably damaging	Het
Wnk1	A	G	6: 119,952,818	V1246A	probably damaging	Het
Zcchc7	A	G	4: 44,929,124	T38A	possibly damaging	Het
Zfp236	A	G	18: 82,646,005	S552P	probably damaging	Het

Other mutations in Sall1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01062:Sall1	APN	8	89033344	missense	probably damaging	1.00
IGL01670:Sall1	APN	8	89031571	missense	probably benign	0.01
IGL01795:Sall1	APN	8	89028680	missense	probably benign	0.02
IGL02041:Sall1	APN	8	89031469	missense	probably damaging	1.00
IGL02078:Sall1	APN	8	89030375	missense	probably damaging	0.99
IGL02105:Sall1	APN	8	89032568	missense	probably damaging	0.99
IGL02354:Sall1	APN	8	89033049	missense	probably benign	0.10
IGL02727:Sall1	APN	8	89030755	missense	probably damaging	1.00
IGL02943:Sall1	APN	8	89031121	missense	probably damaging	0.99
IGL03179:Sall1	APN	8	89031661	missense	probably benign	0.00
PIT4651001:Sall1	UTSW	8	89031103	missense	probably damaging	1.00
R0089:Sall1	UTSW	8	89030268	missense	probably benign	0.09
R0386:Sall1	UTSW	8	89032604	missense	probably damaging	1.00
R0532:Sall1	UTSW	8	89033191	missense	probably benign
R0555:Sall1	UTSW	8	89031758	missense	probably benign	0.16
R1203:Sall1	UTSW	8	89031934	missense	probably damaging	1.00
R1406:Sall1	UTSW	8	89032444	missense	probably benign	0.34
R1406:Sall1	UTSW	8	89032444	missense	probably benign	0.34
R1477:Sall1	UTSW	8	89032882	missense	probably damaging	1.00
R1692:Sall1	UTSW	8	89028400	missense	probably benign	0.00
R1839:Sall1	UTSW	8	89028716	missense	possibly damaging	0.89
R2016:Sall1	UTSW	8	89028409	missense	probably benign	0.10
R2041:Sall1	UTSW	8	89032801	missense	probably benign
R3808:Sall1	UTSW	8	89031473	nonsense	probably null
R3816:Sall1	UTSW	8	89032675	missense	probably benign	0.00
R4085:Sall1	UTSW	8	89028509	missense	probably benign
R4604:Sall1	UTSW	8	89030341	missense	probably damaging	1.00
R4701:Sall1	UTSW	8	89031160	missense	probably damaging	1.00
R5760:Sall1	UTSW	8	89028650	missense	possibly damaging	0.94
R6091:Sall1	UTSW	8	89028619	missense	probably damaging	1.00
R6213:Sall1	UTSW	8	89033058	small deletion	probably benign
R6326:Sall1	UTSW	8	89030268	missense	probably benign	0.09
R6920:Sall1	UTSW	8	89030393	missense	probably damaging	1.00
R6954:Sall1	UTSW	8	89032891	missense	probably damaging	1.00
R7395:Sall1	UTSW	8	89030921	missense	possibly damaging	0.86
R7396:Sall1	UTSW	8	89032768	missense	probably damaging	1.00
R7493:Sall1	UTSW	8	89031053	missense	probably benign	0.32
R7555:Sall1	UTSW	8	89033158	missense	possibly damaging	0.90
R7672:Sall1	UTSW	8	89031299	missense	probably damaging	0.99
R7759:Sall1	UTSW	8	89042351	critical splice donor site	probably null
R7834:Sall1	UTSW	8	89033374	missense	probably benign	0.42
R8023:Sall1	UTSW	8	89032543	missense	probably damaging	0.99
R8166:Sall1	UTSW	8	89028518	missense	probably benign	0.27
R8708:Sall1	UTSW	8	89032855	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTTATTGCGAATGCTGGTGAGGAC -3'
(R):5'- CTGCTCATCTCAACCCTCATGGAAC -3'

Sequencing Primer
(F):5'- ATGCTGGTGAGGACGATGC -3'
(R):5'- ATGGAACAACTCCTGGCTCTG -3'

Posted On

2014-03-14