Incidental Mutation 'R1449:Foxred1'
ID 159137
Institutional Source Beutler Lab
Gene Symbol Foxred1
Ensembl Gene ENSMUSG00000039048
Gene Name FAD-dependent oxidoreductase domain containing 1
Synonyms Tex23, TEG-23
MMRRC Submission 039504-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1449 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 35204206-35211055 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 35209442 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 132 (S132P)
Ref Sequence ENSEMBL: ENSMUSP00000117147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034541] [ENSMUST00000043805] [ENSMUST00000127996] [ENSMUST00000135054] [ENSMUST00000138287] [ENSMUST00000138692] [ENSMUST00000139703] [ENSMUST00000142595] [ENSMUST00000151658] [ENSMUST00000154691]
AlphaFold Q3TQB2
Predicted Effect probably benign
Transcript: ENSMUST00000034541
SMART Domains Protein: ENSMUSP00000034541
Gene: ENSMUSG00000032042

DomainStartEndE-ValueType
Pfam:SRP-alpha_N 27 301 4.4e-69 PFAM
SRP54_N 318 395 4.04e-6 SMART
AAA 415 568 9.65e-10 SMART
SRP54 416 635 3.47e-78 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000043805
AA Change: S132P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038924
Gene: ENSMUSG00000039048
AA Change: S132P

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 462 2.8e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000127996
AA Change: S132P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118037
Gene: ENSMUSG00000039048
AA Change: S132P

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 456 1.8e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130072
Predicted Effect probably benign
Transcript: ENSMUST00000135054
SMART Domains Protein: ENSMUSP00000115301
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
Pfam:DAO 3 140 1.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138287
Predicted Effect probably benign
Transcript: ENSMUST00000138692
SMART Domains Protein: ENSMUSP00000120556
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139703
AA Change: S132P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122535
Gene: ENSMUSG00000039048
AA Change: S132P

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 184 1.6e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140177
Predicted Effect probably damaging
Transcript: ENSMUST00000142595
AA Change: S132P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117147
Gene: ENSMUSG00000039048
AA Change: S132P

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 187 3.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151082
Predicted Effect silent
Transcript: ENSMUST00000151658
SMART Domains Protein: ENSMUSP00000120284
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 121 5.8e-9 PFAM
low complexity region 128 138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154005
Predicted Effect probably benign
Transcript: ENSMUST00000154691
SMART Domains Protein: ENSMUSP00000123496
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216618
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a FAD-dependent oxidoreductase domain. The encoded protein is localized to the mitochondria and may function as a chaperone protein required for the function of mitochondrial complex I. Mutations in this gene are associated with mitochondrial complex I deficiency. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A G 4: 137,455,355 N274D possibly damaging Het
6430571L13Rik T A 9: 107,342,490 N47K probably damaging Het
Aasdh C T 5: 76,886,289 A472T probably benign Het
Abca13 A G 11: 9,298,580 T2776A probably damaging Het
Adamts10 T A 17: 33,545,639 V711D probably damaging Het
Adrb3 G A 8: 27,227,387 R345C probably damaging Het
Ak7 T C 12: 105,742,261 V325A possibly damaging Het
Armc6 G A 8: 70,225,293 L129F probably benign Het
Bend6 T C 1: 33,878,343 N10S probably benign Het
Bmpr1b T C 3: 141,871,373 E59G possibly damaging Het
Brd3 A G 2: 27,450,251 probably null Het
Brd3 A G 2: 27,457,016 Y369H probably damaging Het
Cacna1e C T 1: 154,485,662 probably null Het
Camk4 A G 18: 32,939,475 D27G probably damaging Het
Camkk1 T G 11: 73,033,884 S308A probably damaging Het
Catsperb A G 12: 101,588,197 T717A probably benign Het
Cdh23 A T 10: 60,376,951 S1563R probably damaging Het
Cep44 A T 8: 56,540,950 S197R probably benign Het
Col3a1 T A 1: 45,321,611 I67N unknown Het
Dcaf12l1 T C X: 44,789,427 T165A probably benign Het
Dicer1 T C 12: 104,729,243 Y143C possibly damaging Het
Dlg5 A G 14: 24,135,643 I1898T possibly damaging Het
Dnah1 T C 14: 31,263,951 N3762D probably damaging Het
Dscaml1 A T 9: 45,742,223 T1382S possibly damaging Het
Entpd3 A T 9: 120,566,489 R513W probably damaging Het
Ftsj3 T C 11: 106,253,000 I273V probably benign Het
Hsd17b7 C T 1: 169,959,682 probably null Het
Iars T A 13: 49,733,710 V1253D probably damaging Het
Iqsec1 T A 6: 90,690,808 K216* probably null Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Kcnk2 G A 1: 189,340,026 S35L probably benign Het
Kif13a T C 13: 46,812,736 Y402C probably damaging Het
Lamc1 A G 1: 153,250,495 S484P probably benign Het
Lap3 T C 5: 45,509,519 probably null Het
Lhx8 G T 3: 154,328,105 S46* probably null Het
Lin7a T C 10: 107,323,952 S42P probably damaging Het
Lrba G A 3: 86,354,278 R1513Q probably damaging Het
Maml2 C A 9: 13,620,684 P398Q possibly damaging Het
Mast2 T C 4: 116,309,013 I1201V probably damaging Het
Mmp20 A T 9: 7,642,768 D201V probably damaging Het
Morn5 T A 2: 36,057,080 C123* probably null Het
Mrpl4 A G 9: 21,007,511 K175E possibly damaging Het
Nav3 A T 10: 109,853,511 S302T probably benign Het
Ndrg2 T C 14: 51,908,134 Y217C probably damaging Het
Nfx1 A G 4: 40,976,803 D159G probably damaging Het
Nlrp9b A T 7: 20,023,164 T109S possibly damaging Het
Npepps A G 11: 97,207,154 Y909H probably benign Het
Olfr1510 A G 14: 52,410,567 C102R probably damaging Het
Olfr559 A T 7: 102,724,190 F100Y probably damaging Het
Olfr740 A G 14: 50,453,921 N290D probably damaging Het
Olfr801 T A 10: 129,670,369 D50V probably damaging Het
Olfr810 A C 10: 129,790,854 V245G probably damaging Het
Pcdh1 T C 18: 38,189,876 H968R probably damaging Het
Pde1b T A 15: 103,525,043 I296N probably damaging Het
Phldb1 T A 9: 44,716,633 T172S probably benign Het
Plxdc2 T C 2: 16,660,781 V215A possibly damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
Pou6f2 G T 13: 18,172,415 Q31K probably damaging Het
Psd T A 19: 46,324,811 Y40F probably damaging Het
Rnf126 T C 10: 79,761,614 N155D probably benign Het
Rpl36-ps3 C A 12: 12,912,031 noncoding transcript Het
Rrp15 C A 1: 186,736,268 V184F possibly damaging Het
Rslcan18 G T 13: 67,102,100 L24M possibly damaging Het
Sall1 A G 8: 89,032,483 I331T probably benign Het
Slamf7 A T 1: 171,641,038 N95K possibly damaging Het
Slc1a6 T C 10: 78,800,117 Y339H probably damaging Het
Slc39a8 A G 3: 135,826,685 N72D probably benign Het
Slf1 A G 13: 77,083,449 S604P probably damaging Het
Slfn4 C T 11: 83,188,993 T110M probably benign Het
Tnpo1 T C 13: 98,878,712 T116A probably damaging Het
Tor1b T C 2: 30,955,881 I190T probably damaging Het
Ttn C A 2: 76,969,794 E357* probably null Het
Tubg2 G T 11: 101,156,873 E95* probably null Het
Ubap2 A G 4: 41,209,351 probably null Het
Ube2i T C 17: 25,268,564 D67G possibly damaging Het
Ubxn11 A G 4: 134,124,892 E50G probably damaging Het
Wnk1 A G 6: 119,952,818 V1246A probably damaging Het
Zcchc7 A G 4: 44,929,124 T38A possibly damaging Het
Zfp236 A G 18: 82,646,005 S552P probably damaging Het
Other mutations in Foxred1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02163:Foxred1 APN 9 35205896 missense probably damaging 1.00
IGL02314:Foxred1 APN 9 35205968 missense probably damaging 1.00
IGL02379:Foxred1 APN 9 35209986 missense probably benign 0.44
IGL02558:Foxred1 APN 9 35210133 missense probably damaging 1.00
PIT4494001:Foxred1 UTSW 9 35209059 missense possibly damaging 0.95
R0220:Foxred1 UTSW 9 35209453 missense probably damaging 1.00
R0605:Foxred1 UTSW 9 35204882 missense possibly damaging 0.68
R0763:Foxred1 UTSW 9 35207473 splice site probably null
R1136:Foxred1 UTSW 9 35205037 missense probably benign 0.25
R1757:Foxred1 UTSW 9 35210834 missense probably benign 0.16
R2157:Foxred1 UTSW 9 35205363 missense probably damaging 1.00
R2434:Foxred1 UTSW 9 35205658 missense probably damaging 0.99
R3713:Foxred1 UTSW 9 35210890 start codon destroyed probably null
R4012:Foxred1 UTSW 9 35206275 missense possibly damaging 0.48
R4666:Foxred1 UTSW 9 35210855 intron probably benign
R4934:Foxred1 UTSW 9 35209914 intron probably benign
R5488:Foxred1 UTSW 9 35209970 missense probably damaging 1.00
R5489:Foxred1 UTSW 9 35209970 missense probably damaging 1.00
R5828:Foxred1 UTSW 9 35210196 intron probably benign
R5840:Foxred1 UTSW 9 35210139 missense probably damaging 0.99
R7037:Foxred1 UTSW 9 35207548 missense probably benign 0.04
R7599:Foxred1 UTSW 9 35205636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAGGTGGCAGCATCCTTTTC -3'
(R):5'- TGACAGCTTCCATTGCAGGATTCC -3'

Sequencing Primer
(F):5'- CCAGGTACTCCTGAGTGCAAAG -3'
(R):5'- CATGACAGTCTACGTCGGTT -3'
Posted On 2014-03-14