Incidental Mutation 'R1449:Catsperb'
ID 159157
Institutional Source Beutler Lab
Gene Symbol Catsperb
Ensembl Gene ENSMUSG00000047014
Gene Name cation channel sperm associated auxiliary subunit beta
Synonyms 4932415G16Rik
MMRRC Submission 039504-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock # R1449 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 101404653-101626009 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 101588197 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 717 (T717A)
Ref Sequence ENSEMBL: ENSMUSP00000052089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055156] [ENSMUST00000221241]
AlphaFold A2RTF1
Predicted Effect probably benign
Transcript: ENSMUST00000055156
AA Change: T717A

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000052089
Gene: ENSMUSG00000047014
AA Change: T717A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
Pfam:CATSPERB 569 1088 1.1e-258 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221965
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A G 4: 137,455,355 N274D possibly damaging Het
6430571L13Rik T A 9: 107,342,490 N47K probably damaging Het
Aasdh C T 5: 76,886,289 A472T probably benign Het
Abca13 A G 11: 9,298,580 T2776A probably damaging Het
Adamts10 T A 17: 33,545,639 V711D probably damaging Het
Adrb3 G A 8: 27,227,387 R345C probably damaging Het
Ak7 T C 12: 105,742,261 V325A possibly damaging Het
Armc6 G A 8: 70,225,293 L129F probably benign Het
Bend6 T C 1: 33,878,343 N10S probably benign Het
Bmpr1b T C 3: 141,871,373 E59G possibly damaging Het
Brd3 A G 2: 27,450,251 probably null Het
Brd3 A G 2: 27,457,016 Y369H probably damaging Het
Cacna1e C T 1: 154,485,662 probably null Het
Camk4 A G 18: 32,939,475 D27G probably damaging Het
Camkk1 T G 11: 73,033,884 S308A probably damaging Het
Cdh23 A T 10: 60,376,951 S1563R probably damaging Het
Cep44 A T 8: 56,540,950 S197R probably benign Het
Col3a1 T A 1: 45,321,611 I67N unknown Het
Dcaf12l1 T C X: 44,789,427 T165A probably benign Het
Dicer1 T C 12: 104,729,243 Y143C possibly damaging Het
Dlg5 A G 14: 24,135,643 I1898T possibly damaging Het
Dnah1 T C 14: 31,263,951 N3762D probably damaging Het
Dscaml1 A T 9: 45,742,223 T1382S possibly damaging Het
Entpd3 A T 9: 120,566,489 R513W probably damaging Het
Foxred1 A G 9: 35,209,442 S132P probably damaging Het
Ftsj3 T C 11: 106,253,000 I273V probably benign Het
Hsd17b7 C T 1: 169,959,682 probably null Het
Iars T A 13: 49,733,710 V1253D probably damaging Het
Iqsec1 T A 6: 90,690,808 K216* probably null Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Kcnk2 G A 1: 189,340,026 S35L probably benign Het
Kif13a T C 13: 46,812,736 Y402C probably damaging Het
Lamc1 A G 1: 153,250,495 S484P probably benign Het
Lap3 T C 5: 45,509,519 probably null Het
Lhx8 G T 3: 154,328,105 S46* probably null Het
Lin7a T C 10: 107,323,952 S42P probably damaging Het
Lrba G A 3: 86,354,278 R1513Q probably damaging Het
Maml2 C A 9: 13,620,684 P398Q possibly damaging Het
Mast2 T C 4: 116,309,013 I1201V probably damaging Het
Mmp20 A T 9: 7,642,768 D201V probably damaging Het
Morn5 T A 2: 36,057,080 C123* probably null Het
Mrpl4 A G 9: 21,007,511 K175E possibly damaging Het
Nav3 A T 10: 109,853,511 S302T probably benign Het
Ndrg2 T C 14: 51,908,134 Y217C probably damaging Het
Nfx1 A G 4: 40,976,803 D159G probably damaging Het
Nlrp9b A T 7: 20,023,164 T109S possibly damaging Het
Npepps A G 11: 97,207,154 Y909H probably benign Het
Olfr1510 A G 14: 52,410,567 C102R probably damaging Het
Olfr559 A T 7: 102,724,190 F100Y probably damaging Het
Olfr740 A G 14: 50,453,921 N290D probably damaging Het
Olfr801 T A 10: 129,670,369 D50V probably damaging Het
Olfr810 A C 10: 129,790,854 V245G probably damaging Het
Pcdh1 T C 18: 38,189,876 H968R probably damaging Het
Pde1b T A 15: 103,525,043 I296N probably damaging Het
Phldb1 T A 9: 44,716,633 T172S probably benign Het
Plxdc2 T C 2: 16,660,781 V215A possibly damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
Pou6f2 G T 13: 18,172,415 Q31K probably damaging Het
Psd T A 19: 46,324,811 Y40F probably damaging Het
Rnf126 T C 10: 79,761,614 N155D probably benign Het
Rpl36-ps3 C A 12: 12,912,031 noncoding transcript Het
Rrp15 C A 1: 186,736,268 V184F possibly damaging Het
Rslcan18 G T 13: 67,102,100 L24M possibly damaging Het
Sall1 A G 8: 89,032,483 I331T probably benign Het
Slamf7 A T 1: 171,641,038 N95K possibly damaging Het
Slc1a6 T C 10: 78,800,117 Y339H probably damaging Het
Slc39a8 A G 3: 135,826,685 N72D probably benign Het
Slf1 A G 13: 77,083,449 S604P probably damaging Het
Slfn4 C T 11: 83,188,993 T110M probably benign Het
Tnpo1 T C 13: 98,878,712 T116A probably damaging Het
Tor1b T C 2: 30,955,881 I190T probably damaging Het
Ttn C A 2: 76,969,794 E357* probably null Het
Tubg2 G T 11: 101,156,873 E95* probably null Het
Ubap2 A G 4: 41,209,351 probably null Het
Ube2i T C 17: 25,268,564 D67G possibly damaging Het
Ubxn11 A G 4: 134,124,892 E50G probably damaging Het
Wnk1 A G 6: 119,952,818 V1246A probably damaging Het
Zcchc7 A G 4: 44,929,124 T38A possibly damaging Het
Zfp236 A G 18: 82,646,005 S552P probably damaging Het
Other mutations in Catsperb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00532:Catsperb APN 12 101463119 missense probably damaging 1.00
IGL00580:Catsperb APN 12 101591529 missense probably benign 0.01
IGL00661:Catsperb APN 12 101588098 missense probably damaging 1.00
IGL00979:Catsperb APN 12 101415325 missense probably benign 0.34
IGL01154:Catsperb APN 12 101625681 missense possibly damaging 0.79
IGL01360:Catsperb APN 12 101625254 missense probably damaging 1.00
IGL01607:Catsperb APN 12 101480726 splice site probably benign
IGL01679:Catsperb APN 12 101591582 splice site probably null
IGL01827:Catsperb APN 12 101591540 missense probably benign 0.00
IGL01866:Catsperb APN 12 101509311 nonsense probably null
IGL02161:Catsperb APN 12 101409415 splice site probably benign
IGL02177:Catsperb APN 12 101541462 missense probably damaging 1.00
IGL02618:Catsperb APN 12 101480724 splice site probably benign
IGL02721:Catsperb APN 12 101625297 missense probably null 1.00
IGL02828:Catsperb APN 12 101480782 missense probably benign 0.00
BB001:Catsperb UTSW 12 101520565 missense probably benign 0.02
BB011:Catsperb UTSW 12 101520565 missense probably benign 0.02
R0571:Catsperb UTSW 12 101602774 missense possibly damaging 0.72
R0727:Catsperb UTSW 12 101594355 splice site probably null
R0842:Catsperb UTSW 12 101463048 missense probably damaging 1.00
R1187:Catsperb UTSW 12 101625732 missense probably benign 0.07
R1432:Catsperb UTSW 12 101622217 missense probably damaging 1.00
R1488:Catsperb UTSW 12 101594267 missense probably damaging 0.97
R1540:Catsperb UTSW 12 101412330 missense probably benign 0.02
R1560:Catsperb UTSW 12 101625726 missense probably benign 0.01
R1563:Catsperb UTSW 12 101588102 missense probably damaging 1.00
R1583:Catsperb UTSW 12 101463114 missense probably damaging 0.96
R1989:Catsperb UTSW 12 101602711 missense probably damaging 1.00
R1993:Catsperb UTSW 12 101602767 missense possibly damaging 0.86
R1995:Catsperb UTSW 12 101602767 missense possibly damaging 0.86
R2037:Catsperb UTSW 12 101507962 missense probably damaging 1.00
R2186:Catsperb UTSW 12 101480782 missense probably benign 0.00
R2217:Catsperb UTSW 12 101594219 missense probably damaging 0.99
R2391:Catsperb UTSW 12 101624706 missense probably damaging 1.00
R2679:Catsperb UTSW 12 101463145 missense probably damaging 1.00
R3848:Catsperb UTSW 12 101509326 missense probably damaging 0.98
R4023:Catsperb UTSW 12 101602683 nonsense probably null
R4507:Catsperb UTSW 12 101480828 critical splice donor site probably null
R4558:Catsperb UTSW 12 101591540 missense possibly damaging 0.94
R4649:Catsperb UTSW 12 101541512 missense probably benign 0.01
R4651:Catsperb UTSW 12 101541512 missense probably benign 0.01
R4866:Catsperb UTSW 12 101507949 missense probably damaging 1.00
R4873:Catsperb UTSW 12 101587985 missense possibly damaging 0.90
R4875:Catsperb UTSW 12 101587985 missense possibly damaging 0.90
R4897:Catsperb UTSW 12 101602766 missense probably damaging 0.98
R5002:Catsperb UTSW 12 101520554 missense probably benign
R5137:Catsperb UTSW 12 101549811 missense probably damaging 0.96
R5396:Catsperb UTSW 12 101594284 missense possibly damaging 0.90
R5450:Catsperb UTSW 12 101446068 missense possibly damaging 0.92
R5484:Catsperb UTSW 12 101575916 missense probably benign 0.38
R5846:Catsperb UTSW 12 101602766 missense probably damaging 0.98
R5905:Catsperb UTSW 12 101602700 missense possibly damaging 0.69
R5906:Catsperb UTSW 12 101510462 missense probably damaging 1.00
R6034:Catsperb UTSW 12 101575832 missense probably benign
R6034:Catsperb UTSW 12 101575832 missense probably benign
R6149:Catsperb UTSW 12 101549839 missense probably damaging 1.00
R6165:Catsperb UTSW 12 101575816 missense possibly damaging 0.90
R6210:Catsperb UTSW 12 101412568 splice site probably null
R6297:Catsperb UTSW 12 101591396 splice site probably null
R6302:Catsperb UTSW 12 101588143 missense possibly damaging 0.95
R6681:Catsperb UTSW 12 101624735 nonsense probably null
R6698:Catsperb UTSW 12 101509207 missense probably damaging 1.00
R6869:Catsperb UTSW 12 101480737 missense probably benign 0.09
R6948:Catsperb UTSW 12 101481068 missense probably benign 0.00
R7035:Catsperb UTSW 12 101415334 missense probably damaging 1.00
R7073:Catsperb UTSW 12 101509238 missense probably benign 0.09
R7100:Catsperb UTSW 12 101446038 missense possibly damaging 0.83
R7338:Catsperb UTSW 12 101480984 missense probably benign 0.08
R7397:Catsperb UTSW 12 101588023 missense possibly damaging 0.84
R7413:Catsperb UTSW 12 101481048 missense probably damaging 1.00
R7422:Catsperb UTSW 12 101588034 missense probably damaging 1.00
R7425:Catsperb UTSW 12 101591498 missense probably damaging 0.96
R7578:Catsperb UTSW 12 101588285 missense probably benign 0.01
R7924:Catsperb UTSW 12 101520565 missense probably benign 0.02
R8021:Catsperb UTSW 12 101588063 missense probably benign 0.22
R8060:Catsperb UTSW 12 101602766 missense probably damaging 0.98
R8167:Catsperb UTSW 12 101591455 missense probably benign 0.00
R8323:Catsperb UTSW 12 101409399 missense probably benign 0.02
R8425:Catsperb UTSW 12 101602769 missense probably benign
R8547:Catsperb UTSW 12 101446046 missense probably damaging 1.00
R8671:Catsperb UTSW 12 101594337 missense possibly damaging 0.70
R8906:Catsperb UTSW 12 101520645 missense possibly damaging 0.92
R9227:Catsperb UTSW 12 101549794 missense probably benign
R9230:Catsperb UTSW 12 101549794 missense probably benign
R9298:Catsperb UTSW 12 101594341 missense possibly damaging 0.91
RF006:Catsperb UTSW 12 101575979 critical splice donor site probably null
Z1177:Catsperb UTSW 12 101446048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- gcaGTGACCCATCTCTCCAGCC -3'
(R):5'- CAGGGAGCCACATTGAATATCAAAGAGT -3'

Sequencing Primer
(F):5'- TCAGATCCCCTGCATGAGC -3'
(R):5'- AAAAGCAAGCTTACCTTTTGGA -3'
Posted On 2014-03-14