Mutagenetix > Incidental Mutation

Incidental Mutation 'R1449:Catsperb'

159157

Institutional Source

Beutler Lab

Gene Symbol

Catsperb

Ensembl Gene

ENSMUSG00000047014

Gene Name

cation channel sperm associated auxiliary subunit beta

Synonyms

4932415G16Rik

MMRRC Submission

039504-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

R1449 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101404653-101626009 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101588197 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 717 (T717A)

Ref Sequence

ENSEMBL: ENSMUSP00000052089 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055156] [ENSMUST00000221241]

AlphaFold

A2RTF1

Predicted Effect

probably benign
Transcript: ENSMUST00000055156
AA Change: T717A

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000052089
Gene: ENSMUSG00000047014
AA Change: T717A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	73	95	N/A	INTRINSIC
Pfam:CATSPERB	569	1088	1.1e-258	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000221241

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221965

Coding Region Coverage

1x: 98.8%
3x: 97.9%
10x: 94.7%
20x: 87.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	A	G	4: 137,455,355	N274D	possibly damaging	Het
6430571L13Rik	T	A	9: 107,342,490	N47K	probably damaging	Het
Aasdh	C	T	5: 76,886,289	A472T	probably benign	Het
Abca13	A	G	11: 9,298,580	T2776A	probably damaging	Het
Adamts10	T	A	17: 33,545,639	V711D	probably damaging	Het
Adrb3	G	A	8: 27,227,387	R345C	probably damaging	Het
Ak7	T	C	12: 105,742,261	V325A	possibly damaging	Het
Armc6	G	A	8: 70,225,293	L129F	probably benign	Het
Bend6	T	C	1: 33,878,343	N10S	probably benign	Het
Bmpr1b	T	C	3: 141,871,373	E59G	possibly damaging	Het
Brd3	A	G	2: 27,457,016	Y369H	probably damaging	Het
Brd3	A	G	2: 27,450,251		probably null	Het
Cacna1e	C	T	1: 154,485,662		probably null	Het
Camk4	A	G	18: 32,939,475	D27G	probably damaging	Het
Camkk1	T	G	11: 73,033,884	S308A	probably damaging	Het
Cdh23	A	T	10: 60,376,951	S1563R	probably damaging	Het
Cep44	A	T	8: 56,540,950	S197R	probably benign	Het
Col3a1	T	A	1: 45,321,611	I67N	unknown	Het
Dcaf12l1	T	C	X: 44,789,427	T165A	probably benign	Het
Dicer1	T	C	12: 104,729,243	Y143C	possibly damaging	Het
Dlg5	A	G	14: 24,135,643	I1898T	possibly damaging	Het
Dnah1	T	C	14: 31,263,951	N3762D	probably damaging	Het
Dscaml1	A	T	9: 45,742,223	T1382S	possibly damaging	Het
Entpd3	A	T	9: 120,566,489	R513W	probably damaging	Het
Foxred1	A	G	9: 35,209,442	S132P	probably damaging	Het
Ftsj3	T	C	11: 106,253,000	I273V	probably benign	Het
Hsd17b7	C	T	1: 169,959,682		probably null	Het
Iars	T	A	13: 49,733,710	V1253D	probably damaging	Het
Iqsec1	T	A	6: 90,690,808	K216*	probably null	Het
Itga7	A	G	10: 128,953,501	D971G	probably benign	Het
Kcnk2	G	A	1: 189,340,026	S35L	probably benign	Het
Kif13a	T	C	13: 46,812,736	Y402C	probably damaging	Het
Lamc1	A	G	1: 153,250,495	S484P	probably benign	Het
Lap3	T	C	5: 45,509,519		probably null	Het
Lhx8	G	T	3: 154,328,105	S46*	probably null	Het
Lin7a	T	C	10: 107,323,952	S42P	probably damaging	Het
Lrba	G	A	3: 86,354,278	R1513Q	probably damaging	Het
Maml2	C	A	9: 13,620,684	P398Q	possibly damaging	Het
Mast2	T	C	4: 116,309,013	I1201V	probably damaging	Het
Mmp20	A	T	9: 7,642,768	D201V	probably damaging	Het
Morn5	T	A	2: 36,057,080	C123*	probably null	Het
Mrpl4	A	G	9: 21,007,511	K175E	possibly damaging	Het
Nav3	A	T	10: 109,853,511	S302T	probably benign	Het
Ndrg2	T	C	14: 51,908,134	Y217C	probably damaging	Het
Nfx1	A	G	4: 40,976,803	D159G	probably damaging	Het
Nlrp9b	A	T	7: 20,023,164	T109S	possibly damaging	Het
Npepps	A	G	11: 97,207,154	Y909H	probably benign	Het
Olfr1510	A	G	14: 52,410,567	C102R	probably damaging	Het
Olfr559	A	T	7: 102,724,190	F100Y	probably damaging	Het
Olfr740	A	G	14: 50,453,921	N290D	probably damaging	Het
Olfr801	T	A	10: 129,670,369	D50V	probably damaging	Het
Olfr810	A	C	10: 129,790,854	V245G	probably damaging	Het
Pcdh1	T	C	18: 38,189,876	H968R	probably damaging	Het
Pde1b	T	A	15: 103,525,043	I296N	probably damaging	Het
Phldb1	T	A	9: 44,716,633	T172S	probably benign	Het
Plxdc2	T	C	2: 16,660,781	V215A	possibly damaging	Het
Poln	A	G	5: 34,014,338	I695T	probably damaging	Het
Pou6f2	G	T	13: 18,172,415	Q31K	probably damaging	Het
Psd	T	A	19: 46,324,811	Y40F	probably damaging	Het
Rnf126	T	C	10: 79,761,614	N155D	probably benign	Het
Rpl36-ps3	C	A	12: 12,912,031		noncoding transcript	Het
Rrp15	C	A	1: 186,736,268	V184F	possibly damaging	Het
Rslcan18	G	T	13: 67,102,100	L24M	possibly damaging	Het
Sall1	A	G	8: 89,032,483	I331T	probably benign	Het
Slamf7	A	T	1: 171,641,038	N95K	possibly damaging	Het
Slc1a6	T	C	10: 78,800,117	Y339H	probably damaging	Het
Slc39a8	A	G	3: 135,826,685	N72D	probably benign	Het
Slf1	A	G	13: 77,083,449	S604P	probably damaging	Het
Slfn4	C	T	11: 83,188,993	T110M	probably benign	Het
Tnpo1	T	C	13: 98,878,712	T116A	probably damaging	Het
Tor1b	T	C	2: 30,955,881	I190T	probably damaging	Het
Ttn	C	A	2: 76,969,794	E357*	probably null	Het
Tubg2	G	T	11: 101,156,873	E95*	probably null	Het
Ubap2	A	G	4: 41,209,351		probably null	Het
Ube2i	T	C	17: 25,268,564	D67G	possibly damaging	Het
Ubxn11	A	G	4: 134,124,892	E50G	probably damaging	Het
Wnk1	A	G	6: 119,952,818	V1246A	probably damaging	Het
Zcchc7	A	G	4: 44,929,124	T38A	possibly damaging	Het
Zfp236	A	G	18: 82,646,005	S552P	probably damaging	Het

Other mutations in Catsperb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00532:Catsperb	APN	12	101463119	missense	probably damaging	1.00
IGL00580:Catsperb	APN	12	101591529	missense	probably benign	0.01
IGL00661:Catsperb	APN	12	101588098	missense	probably damaging	1.00
IGL00979:Catsperb	APN	12	101415325	missense	probably benign	0.34
IGL01154:Catsperb	APN	12	101625681	missense	possibly damaging	0.79
IGL01360:Catsperb	APN	12	101625254	missense	probably damaging	1.00
IGL01607:Catsperb	APN	12	101480726	splice site	probably benign
IGL01679:Catsperb	APN	12	101591582	splice site	probably null
IGL01827:Catsperb	APN	12	101591540	missense	probably benign	0.00
IGL01866:Catsperb	APN	12	101509311	nonsense	probably null
IGL02161:Catsperb	APN	12	101409415	splice site	probably benign
IGL02177:Catsperb	APN	12	101541462	missense	probably damaging	1.00
IGL02618:Catsperb	APN	12	101480724	splice site	probably benign
IGL02721:Catsperb	APN	12	101625297	missense	probably null	1.00
IGL02828:Catsperb	APN	12	101480782	missense	probably benign	0.00
BB001:Catsperb	UTSW	12	101520565	missense	probably benign	0.02
BB011:Catsperb	UTSW	12	101520565	missense	probably benign	0.02
R0571:Catsperb	UTSW	12	101602774	missense	possibly damaging	0.72
R0727:Catsperb	UTSW	12	101594355	splice site	probably null
R0842:Catsperb	UTSW	12	101463048	missense	probably damaging	1.00
R1187:Catsperb	UTSW	12	101625732	missense	probably benign	0.07
R1432:Catsperb	UTSW	12	101622217	missense	probably damaging	1.00
R1488:Catsperb	UTSW	12	101594267	missense	probably damaging	0.97
R1540:Catsperb	UTSW	12	101412330	missense	probably benign	0.02
R1560:Catsperb	UTSW	12	101625726	missense	probably benign	0.01
R1563:Catsperb	UTSW	12	101588102	missense	probably damaging	1.00
R1583:Catsperb	UTSW	12	101463114	missense	probably damaging	0.96
R1989:Catsperb	UTSW	12	101602711	missense	probably damaging	1.00
R1993:Catsperb	UTSW	12	101602767	missense	possibly damaging	0.86
R1995:Catsperb	UTSW	12	101602767	missense	possibly damaging	0.86
R2037:Catsperb	UTSW	12	101507962	missense	probably damaging	1.00
R2186:Catsperb	UTSW	12	101480782	missense	probably benign	0.00
R2217:Catsperb	UTSW	12	101594219	missense	probably damaging	0.99
R2391:Catsperb	UTSW	12	101624706	missense	probably damaging	1.00
R2679:Catsperb	UTSW	12	101463145	missense	probably damaging	1.00
R3848:Catsperb	UTSW	12	101509326	missense	probably damaging	0.98
R4023:Catsperb	UTSW	12	101602683	nonsense	probably null
R4507:Catsperb	UTSW	12	101480828	critical splice donor site	probably null
R4558:Catsperb	UTSW	12	101591540	missense	possibly damaging	0.94
R4649:Catsperb	UTSW	12	101541512	missense	probably benign	0.01
R4651:Catsperb	UTSW	12	101541512	missense	probably benign	0.01
R4866:Catsperb	UTSW	12	101507949	missense	probably damaging	1.00
R4873:Catsperb	UTSW	12	101587985	missense	possibly damaging	0.90
R4875:Catsperb	UTSW	12	101587985	missense	possibly damaging	0.90
R4897:Catsperb	UTSW	12	101602766	missense	probably damaging	0.98
R5002:Catsperb	UTSW	12	101520554	missense	probably benign
R5137:Catsperb	UTSW	12	101549811	missense	probably damaging	0.96
R5396:Catsperb	UTSW	12	101594284	missense	possibly damaging	0.90
R5450:Catsperb	UTSW	12	101446068	missense	possibly damaging	0.92
R5484:Catsperb	UTSW	12	101575916	missense	probably benign	0.38
R5846:Catsperb	UTSW	12	101602766	missense	probably damaging	0.98
R5905:Catsperb	UTSW	12	101602700	missense	possibly damaging	0.69
R5906:Catsperb	UTSW	12	101510462	missense	probably damaging	1.00
R6034:Catsperb	UTSW	12	101575832	missense	probably benign
R6034:Catsperb	UTSW	12	101575832	missense	probably benign
R6149:Catsperb	UTSW	12	101549839	missense	probably damaging	1.00
R6165:Catsperb	UTSW	12	101575816	missense	possibly damaging	0.90
R6210:Catsperb	UTSW	12	101412568	splice site	probably null
R6297:Catsperb	UTSW	12	101591396	splice site	probably null
R6302:Catsperb	UTSW	12	101588143	missense	possibly damaging	0.95
R6681:Catsperb	UTSW	12	101624735	nonsense	probably null
R6698:Catsperb	UTSW	12	101509207	missense	probably damaging	1.00
R6869:Catsperb	UTSW	12	101480737	missense	probably benign	0.09
R6948:Catsperb	UTSW	12	101481068	missense	probably benign	0.00
R7035:Catsperb	UTSW	12	101415334	missense	probably damaging	1.00
R7073:Catsperb	UTSW	12	101509238	missense	probably benign	0.09
R7100:Catsperb	UTSW	12	101446038	missense	possibly damaging	0.83
R7338:Catsperb	UTSW	12	101480984	missense	probably benign	0.08
R7397:Catsperb	UTSW	12	101588023	missense	possibly damaging	0.84
R7413:Catsperb	UTSW	12	101481048	missense	probably damaging	1.00
R7422:Catsperb	UTSW	12	101588034	missense	probably damaging	1.00
R7425:Catsperb	UTSW	12	101591498	missense	probably damaging	0.96
R7578:Catsperb	UTSW	12	101588285	missense	probably benign	0.01
R7924:Catsperb	UTSW	12	101520565	missense	probably benign	0.02
R8021:Catsperb	UTSW	12	101588063	missense	probably benign	0.22
R8060:Catsperb	UTSW	12	101602766	missense	probably damaging	0.98
R8167:Catsperb	UTSW	12	101591455	missense	probably benign	0.00
R8323:Catsperb	UTSW	12	101409399	missense	probably benign	0.02
R8425:Catsperb	UTSW	12	101602769	missense	probably benign
R8547:Catsperb	UTSW	12	101446046	missense	probably damaging	1.00
R8671:Catsperb	UTSW	12	101594337	missense	possibly damaging	0.70
R8906:Catsperb	UTSW	12	101520645	missense	possibly damaging	0.92
R9227:Catsperb	UTSW	12	101549794	missense	probably benign
R9230:Catsperb	UTSW	12	101549794	missense	probably benign
R9298:Catsperb	UTSW	12	101594341	missense	possibly damaging	0.91
RF006:Catsperb	UTSW	12	101575979	critical splice donor site	probably null
Z1177:Catsperb	UTSW	12	101446048	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- gcaGTGACCCATCTCTCCAGCC -3'
(R):5'- CAGGGAGCCACATTGAATATCAAAGAGT -3'

Sequencing Primer
(F):5'- TCAGATCCCCTGCATGAGC -3'
(R):5'- AAAAGCAAGCTTACCTTTTGGA -3'

Posted On

2014-03-14