Mutagenetix > Incidental Mutations

Incidental Mutation 'R1449:Dicer1'

159158

Institutional Source

Beutler Lab

Gene Symbol

Dicer1

Ensembl Gene

ENSMUSG00000041415

Gene Name

dicer 1, ribonuclease type III

Synonyms

D12Ertd7e

MMRRC Submission

039504-MU

Accession Numbers

Ncbi RefSeq: NM_148948.2; MGI:2177178

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1449 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104687742-104751952 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104729243 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 143 (Y143C)

Ref Sequence

ENSEMBL: ENSMUSP00000043676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041987] [ENSMUST00000222002]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041987
AA Change: Y143C

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000043676
Gene: ENSMUSG00000041415
AA Change: Y143C

Domain	Start	End	E-Value	Type
DEXDc	30	233	5.14e-24	SMART
low complexity region	403	419	N/A	INTRINSIC
HELICc	449	546	3.15e-10	SMART
Pfam:Dicer_dimer	620	707	1.4e-25	PFAM
low complexity region	713	723	N/A	INTRINSIC
PAZ	881	1056	1.67e-48	SMART
Blast:PAZ	1080	1129	2e-8	BLAST
RIBOc	1285	1582	1.83e-35	SMART
RIBOc	1665	1831	5.97e-49	SMART
DSRM	1834	1897	6.89e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221293

Predicted Effect

probably benign
Transcript: ENSMUST00000222002
AA Change: Y143C

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)

Coding Region Coverage

1x: 98.8%
3x: 97.9%
10x: 94.7%
20x: 87.4%

Validation Efficiency

MGI Phenotype

Strain: 3589209; 3809262; 2681012; 3576927
Lethality: E7-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mutation of this locus results in arrest of early embryonic development. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(14) Gene trapped(11)

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	A	G	4: 137,455,355	N274D	possibly damaging	Het
6430571L13Rik	T	A	9: 107,342,490	N47K	probably damaging	Het
Aasdh	C	T	5: 76,886,289	A472T	probably benign	Het
Abca13	A	G	11: 9,298,580	T2776A	probably damaging	Het
Adamts10	T	A	17: 33,545,639	V711D	probably damaging	Het
Adrb3	G	A	8: 27,227,387	R345C	probably damaging	Het
Ak7	T	C	12: 105,742,261	V325A	possibly damaging	Het
Armc6	G	A	8: 70,225,293	L129F	probably benign	Het
Bend6	T	C	1: 33,878,343	N10S	probably benign	Het
Bmpr1b	T	C	3: 141,871,373	E59G	possibly damaging	Het
Brd3	A	G	2: 27,450,251		probably null	Het
Brd3	A	G	2: 27,457,016	Y369H	probably damaging	Het
Cacna1e	C	T	1: 154,485,662		probably null	Het
Camk4	A	G	18: 32,939,475	D27G	probably damaging	Het
Camkk1	T	G	11: 73,033,884	S308A	probably damaging	Het
Catsperb	A	G	12: 101,588,197	T717A	probably benign	Het
Cdh23	A	T	10: 60,376,951	S1563R	probably damaging	Het
Cep44	A	T	8: 56,540,950	S197R	probably benign	Het
Col3a1	T	A	1: 45,321,611	I67N	unknown	Het
Dcaf12l1	T	C	X: 44,789,427	T165A	probably benign	Het
Dlg5	A	G	14: 24,135,643	I1898T	possibly damaging	Het
Dnah1	T	C	14: 31,263,951	N3762D	probably damaging	Het
Dscaml1	A	T	9: 45,742,223	T1382S	possibly damaging	Het
Entpd3	A	T	9: 120,566,489	R513W	probably damaging	Het
Foxred1	A	G	9: 35,209,442	S132P	probably damaging	Het
Ftsj3	T	C	11: 106,253,000	I273V	probably benign	Het
Hsd17b7	C	T	1: 169,959,682		probably null	Het
Iars	T	A	13: 49,733,710	V1253D	probably damaging	Het
Iqsec1	T	A	6: 90,690,808	K216*	probably null	Het
Itga7	A	G	10: 128,953,501	D971G	probably benign	Het
Kcnk2	G	A	1: 189,340,026	S35L	probably benign	Het
Kif13a	T	C	13: 46,812,736	Y402C	probably damaging	Het
Lamc1	A	G	1: 153,250,495	S484P	probably benign	Het
Lap3	T	C	5: 45,509,519		probably null	Het
Lhx8	G	T	3: 154,328,105	S46*	probably null	Het
Lin7a	T	C	10: 107,323,952	S42P	probably damaging	Het
Lrba	G	A	3: 86,354,278	R1513Q	probably damaging	Het
Maml2	C	A	9: 13,620,684	P398Q	possibly damaging	Het
Mast2	T	C	4: 116,309,013	I1201V	probably damaging	Het
Mmp20	A	T	9: 7,642,768	D201V	probably damaging	Het
Morn5	T	A	2: 36,057,080	C123*	probably null	Het
Mrpl4	A	G	9: 21,007,511	K175E	possibly damaging	Het
Nav3	A	T	10: 109,853,511	S302T	probably benign	Het
Ndrg2	T	C	14: 51,908,134	Y217C	probably damaging	Het
Nfx1	A	G	4: 40,976,803	D159G	probably damaging	Het
Nlrp9b	A	T	7: 20,023,164	T109S	possibly damaging	Het
Npepps	A	G	11: 97,207,154	Y909H	probably benign	Het
Olfr1510	A	G	14: 52,410,567	C102R	probably damaging	Het
Olfr559	A	T	7: 102,724,190	F100Y	probably damaging	Het
Olfr740	A	G	14: 50,453,921	N290D	probably damaging	Het
Olfr801	T	A	10: 129,670,369	D50V	probably damaging	Het
Olfr810	A	C	10: 129,790,854	V245G	probably damaging	Het
Pcdh1	T	C	18: 38,189,876	H968R	probably damaging	Het
Pde1b	T	A	15: 103,525,043	I296N	probably damaging	Het
Phldb1	T	A	9: 44,716,633	T172S	probably benign	Het
Plxdc2	T	C	2: 16,660,781	V215A	possibly damaging	Het
Poln	A	G	5: 34,014,338	I695T	probably damaging	Het
Pou6f2	G	T	13: 18,172,415	Q31K	probably damaging	Het
Psd	T	A	19: 46,324,811	Y40F	probably damaging	Het
Rnf126	T	C	10: 79,761,614	N155D	probably benign	Het
Rpl36-ps3	C	A	12: 12,912,031		noncoding transcript	Het
Rrp15	C	A	1: 186,736,268	V184F	possibly damaging	Het
Rslcan18	G	T	13: 67,102,100	L24M	possibly damaging	Het
Sall1	A	G	8: 89,032,483	I331T	probably benign	Het
Slamf7	A	T	1: 171,641,038	N95K	possibly damaging	Het
Slc1a6	T	C	10: 78,800,117	Y339H	probably damaging	Het
Slc39a8	A	G	3: 135,826,685	N72D	probably benign	Het
Slf1	A	G	13: 77,083,449	S604P	probably damaging	Het
Slfn4	C	T	11: 83,188,993	T110M	probably benign	Het
Tnpo1	T	C	13: 98,878,712	T116A	probably damaging	Het
Tor1b	T	C	2: 30,955,881	I190T	probably damaging	Het
Ttn	C	A	2: 76,969,794	E357*	probably null	Het
Tubg2	G	T	11: 101,156,873	E95*	probably null	Het
Ubap2	A	G	4: 41,209,351		probably null	Het
Ube2i	T	C	17: 25,268,564	D67G	possibly damaging	Het
Ubxn11	A	G	4: 134,124,892	E50G	probably damaging	Het
Wnk1	A	G	6: 119,952,818	V1246A	probably damaging	Het
Zcchc7	A	G	4: 44,929,124	T38A	possibly damaging	Het
Zfp236	A	G	18: 82,646,005	S552P	probably damaging	Het

Other mutations in Dicer1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Dicer1	APN	12	104696772	missense	possibly damaging	0.93
IGL01061:Dicer1	APN	12	104706327	missense	probably null	0.75
IGL01527:Dicer1	APN	12	104691610	nonsense	probably null
IGL01597:Dicer1	APN	12	104705210	nonsense	probably null
IGL01636:Dicer1	APN	12	104722241	missense	probably damaging	1.00
IGL01717:Dicer1	APN	12	104702787	nonsense	probably null
IGL01765:Dicer1	APN	12	104706740	missense	probably damaging	1.00
IGL01871:Dicer1	APN	12	104704180	missense	probably damaging	1.00
IGL02316:Dicer1	APN	12	104702553	missense	probably damaging	1.00
IGL02317:Dicer1	APN	12	104697020	missense	probably damaging	1.00
IGL02539:Dicer1	APN	12	104697035	missense	probably damaging	0.97
IGL02544:Dicer1	APN	12	104714832	missense	probably damaging	1.00
IGL02664:Dicer1	APN	12	104705129	missense	probably damaging	1.00
IGL02667:Dicer1	APN	12	104714906	missense	probably damaging	1.00
IGL03353:Dicer1	APN	12	104713107	missense	probably damaging	1.00
IGL03377:Dicer1	APN	12	104712197	missense	probably damaging	0.98
everest	UTSW	12	104705128	missense	probably damaging	1.00
PIT4480001:Dicer1	UTSW	12	104696544	missense	probably benign
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0219:Dicer1	UTSW	12	104692125	critical splice donor site	probably null
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0385:Dicer1	UTSW	12	104704174	missense	probably damaging	1.00
R0402:Dicer1	UTSW	12	104731064	missense	probably benign	0.04
R0426:Dicer1	UTSW	12	104702542	missense	probably damaging	1.00
R0453:Dicer1	UTSW	12	104702630	missense	probably benign
R0502:Dicer1	UTSW	12	104705060	missense	probably damaging	1.00
R0507:Dicer1	UTSW	12	104691658	missense	probably damaging	1.00
R0511:Dicer1	UTSW	12	104702841	missense	possibly damaging	0.95
R0523:Dicer1	UTSW	12	104702491	missense	probably damaging	1.00
R0559:Dicer1	UTSW	12	104706301	missense	probably damaging	1.00
R0600:Dicer1	UTSW	12	104706864	missense	probably damaging	1.00
R0707:Dicer1	UTSW	12	104706885	missense	probably damaging	1.00
R1225:Dicer1	UTSW	12	104691607	missense	probably damaging	0.98
R1351:Dicer1	UTSW	12	104729142	missense	probably damaging	0.99
R1575:Dicer1	UTSW	12	104721969	critical splice donor site	probably null
R1642:Dicer1	UTSW	12	104713156	missense	probably damaging	1.00
R1651:Dicer1	UTSW	12	104708805	missense	probably damaging	1.00
R1658:Dicer1	UTSW	12	104700414	missense	probably benign
R1815:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1816:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1927:Dicer1	UTSW	12	104702884	missense	possibly damaging	0.91
R2113:Dicer1	UTSW	12	104713214	missense	probably damaging	1.00
R2129:Dicer1	UTSW	12	104722031	missense	probably damaging	1.00
R2157:Dicer1	UTSW	12	104702949	missense	probably benign	0.17
R2202:Dicer1	UTSW	12	104731038	missense	probably damaging	0.98
R2203:Dicer1	UTSW	12	104731038	missense	probably damaging	0.98
R2243:Dicer1	UTSW	12	104730188	missense	probably damaging	0.99
R4237:Dicer1	UTSW	12	104729228	missense	possibly damaging	0.48
R4419:Dicer1	UTSW	12	104705114	missense	probably damaging	1.00
R4482:Dicer1	UTSW	12	104706277	missense	probably damaging	1.00
R4564:Dicer1	UTSW	12	104704751	nonsense	probably null
R4776:Dicer1	UTSW	12	104692446	missense	probably damaging	0.99
R4834:Dicer1	UTSW	12	104696591	missense	probably benign	0.44
R4904:Dicer1	UTSW	12	104713066	missense	probably benign
R5202:Dicer1	UTSW	12	104694731	nonsense	probably null
R5272:Dicer1	UTSW	12	104704240	missense	probably damaging	1.00
R5363:Dicer1	UTSW	12	104703151	missense	probably damaging	1.00
R5717:Dicer1	UTSW	12	104705128	missense	probably damaging	1.00
R6381:Dicer1	UTSW	12	104696462	missense	probably benign	0.00
R6479:Dicer1	UTSW	12	104696723	missense	probably damaging	0.97
R6956:Dicer1	UTSW	12	104731023	missense	probably damaging	1.00
R7234:Dicer1	UTSW	12	104708849	missense	probably damaging	1.00
R7401:Dicer1	UTSW	12	104712278	missense	probably benign
R7407:Dicer1	UTSW	12	104722351	nonsense	probably null
R7471:Dicer1	UTSW	12	104694710	missense	probably damaging	1.00
R7699:Dicer1	UTSW	12	104705170	missense	probably damaging	1.00
R7768:Dicer1	UTSW	12	104706697	missense	probably damaging	0.99
R7831:Dicer1	UTSW	12	104708800	missense	probably damaging	1.00
R7998:Dicer1	UTSW	12	104704069	missense	probably damaging	1.00
R8010:Dicer1	UTSW	12	104692132	missense	probably damaging	0.99
R8061:Dicer1	UTSW	12	104702818	nonsense	probably null
R8213:Dicer1	UTSW	12	104702693	missense	probably benign	0.00
R8261:Dicer1	UTSW	12	104691606	missense	probably damaging	1.00
R8419:Dicer1	UTSW	12	104702677	missense	probably benign	0.00
R8708:Dicer1	UTSW	12	104728445	missense	possibly damaging	0.65
R8851:Dicer1	UTSW	12	104724041	missense	possibly damaging	0.76
R9220:Dicer1	UTSW	12	104713156	missense	probably damaging	1.00
R9371:Dicer1	UTSW	12	104704732	missense	probably damaging	1.00
R9387:Dicer1	UTSW	12	104729240	missense	possibly damaging	0.48
X0018:Dicer1	UTSW	12	104696934	missense	probably benign	0.00
Z1176:Dicer1	UTSW	12	104731020	missense	probably null	0.97

Predicted Primers

PCR Primer
(F):5'- CCCATTTCTCTGGAACAGTAGCACAA -3'
(R):5'- AGGACTTTCTCTCAGTCTTTCCCACA -3'

Sequencing Primer
(F):5'- cctgacaccctcttctgac -3'
(R):5'- TCAGTCTTTCCCACAAATTTCATC -3'

Posted On

2014-03-14