Incidental Mutation 'R1449:Ak7'
ID 159159
Institutional Source Beutler Lab
Gene Symbol Ak7
Ensembl Gene ENSMUSG00000041323
Gene Name adenylate kinase 7
Synonyms 4930502N02Rik
MMRRC Submission 039504-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1449 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 105705976-105782447 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 105742261 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 325 (V325A)
Ref Sequence ENSEMBL: ENSMUSP00000043145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040876]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000040876
AA Change: V325A

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000043145
Gene: ENSMUSG00000041323
AA Change: V325A

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
Pfam:ADK 431 675 1.4e-9 PFAM
Pfam:Dpy-30 679 720 3.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221981
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice exhibit hydrocephalus, rhinitis, sperm defects and most die before 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A G 4: 137,455,355 N274D possibly damaging Het
6430571L13Rik T A 9: 107,342,490 N47K probably damaging Het
Aasdh C T 5: 76,886,289 A472T probably benign Het
Abca13 A G 11: 9,298,580 T2776A probably damaging Het
Adamts10 T A 17: 33,545,639 V711D probably damaging Het
Adrb3 G A 8: 27,227,387 R345C probably damaging Het
Armc6 G A 8: 70,225,293 L129F probably benign Het
Bend6 T C 1: 33,878,343 N10S probably benign Het
Bmpr1b T C 3: 141,871,373 E59G possibly damaging Het
Brd3 A G 2: 27,450,251 probably null Het
Brd3 A G 2: 27,457,016 Y369H probably damaging Het
Cacna1e C T 1: 154,485,662 probably null Het
Camk4 A G 18: 32,939,475 D27G probably damaging Het
Camkk1 T G 11: 73,033,884 S308A probably damaging Het
Catsperb A G 12: 101,588,197 T717A probably benign Het
Cdh23 A T 10: 60,376,951 S1563R probably damaging Het
Cep44 A T 8: 56,540,950 S197R probably benign Het
Col3a1 T A 1: 45,321,611 I67N unknown Het
Dcaf12l1 T C X: 44,789,427 T165A probably benign Het
Dicer1 T C 12: 104,729,243 Y143C possibly damaging Het
Dlg5 A G 14: 24,135,643 I1898T possibly damaging Het
Dnah1 T C 14: 31,263,951 N3762D probably damaging Het
Dscaml1 A T 9: 45,742,223 T1382S possibly damaging Het
Entpd3 A T 9: 120,566,489 R513W probably damaging Het
Foxred1 A G 9: 35,209,442 S132P probably damaging Het
Ftsj3 T C 11: 106,253,000 I273V probably benign Het
Hsd17b7 C T 1: 169,959,682 probably null Het
Iars T A 13: 49,733,710 V1253D probably damaging Het
Iqsec1 T A 6: 90,690,808 K216* probably null Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Kcnk2 G A 1: 189,340,026 S35L probably benign Het
Kif13a T C 13: 46,812,736 Y402C probably damaging Het
Lamc1 A G 1: 153,250,495 S484P probably benign Het
Lap3 T C 5: 45,509,519 probably null Het
Lhx8 G T 3: 154,328,105 S46* probably null Het
Lin7a T C 10: 107,323,952 S42P probably damaging Het
Lrba G A 3: 86,354,278 R1513Q probably damaging Het
Maml2 C A 9: 13,620,684 P398Q possibly damaging Het
Mast2 T C 4: 116,309,013 I1201V probably damaging Het
Mmp20 A T 9: 7,642,768 D201V probably damaging Het
Morn5 T A 2: 36,057,080 C123* probably null Het
Mrpl4 A G 9: 21,007,511 K175E possibly damaging Het
Nav3 A T 10: 109,853,511 S302T probably benign Het
Ndrg2 T C 14: 51,908,134 Y217C probably damaging Het
Nfx1 A G 4: 40,976,803 D159G probably damaging Het
Nlrp9b A T 7: 20,023,164 T109S possibly damaging Het
Npepps A G 11: 97,207,154 Y909H probably benign Het
Olfr1510 A G 14: 52,410,567 C102R probably damaging Het
Olfr559 A T 7: 102,724,190 F100Y probably damaging Het
Olfr740 A G 14: 50,453,921 N290D probably damaging Het
Olfr801 T A 10: 129,670,369 D50V probably damaging Het
Olfr810 A C 10: 129,790,854 V245G probably damaging Het
Pcdh1 T C 18: 38,189,876 H968R probably damaging Het
Pde1b T A 15: 103,525,043 I296N probably damaging Het
Phldb1 T A 9: 44,716,633 T172S probably benign Het
Plxdc2 T C 2: 16,660,781 V215A possibly damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
Pou6f2 G T 13: 18,172,415 Q31K probably damaging Het
Psd T A 19: 46,324,811 Y40F probably damaging Het
Rnf126 T C 10: 79,761,614 N155D probably benign Het
Rpl36-ps3 C A 12: 12,912,031 noncoding transcript Het
Rrp15 C A 1: 186,736,268 V184F possibly damaging Het
Rslcan18 G T 13: 67,102,100 L24M possibly damaging Het
Sall1 A G 8: 89,032,483 I331T probably benign Het
Slamf7 A T 1: 171,641,038 N95K possibly damaging Het
Slc1a6 T C 10: 78,800,117 Y339H probably damaging Het
Slc39a8 A G 3: 135,826,685 N72D probably benign Het
Slf1 A G 13: 77,083,449 S604P probably damaging Het
Slfn4 C T 11: 83,188,993 T110M probably benign Het
Tnpo1 T C 13: 98,878,712 T116A probably damaging Het
Tor1b T C 2: 30,955,881 I190T probably damaging Het
Ttn C A 2: 76,969,794 E357* probably null Het
Tubg2 G T 11: 101,156,873 E95* probably null Het
Ubap2 A G 4: 41,209,351 probably null Het
Ube2i T C 17: 25,268,564 D67G possibly damaging Het
Ubxn11 A G 4: 134,124,892 E50G probably damaging Het
Wnk1 A G 6: 119,952,818 V1246A probably damaging Het
Zcchc7 A G 4: 44,929,124 T38A possibly damaging Het
Zfp236 A G 18: 82,646,005 S552P probably damaging Het
Other mutations in Ak7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Ak7 APN 12 105713574 missense probably benign 0.06
IGL01859:Ak7 APN 12 105745297 missense probably null
IGL01939:Ak7 APN 12 105734924 missense probably benign 0.06
IGL03233:Ak7 APN 12 105761480 missense probably damaging 1.00
drizzle UTSW 12 105742332 missense probably damaging 1.00
R0453:Ak7 UTSW 12 105716048 missense probably damaging 0.98
R0538:Ak7 UTSW 12 105766617 missense probably damaging 1.00
R0619:Ak7 UTSW 12 105733511 missense probably damaging 1.00
R0724:Ak7 UTSW 12 105710254 missense probably benign 0.00
R1028:Ak7 UTSW 12 105710189 small deletion probably benign
R1112:Ak7 UTSW 12 105713572 missense probably benign
R1523:Ak7 UTSW 12 105766608 missense probably benign 0.18
R1626:Ak7 UTSW 12 105768548 missense probably benign 0.23
R1737:Ak7 UTSW 12 105742332 missense probably damaging 1.00
R1795:Ak7 UTSW 12 105726223 nonsense probably null
R1971:Ak7 UTSW 12 105726245 missense probably damaging 0.98
R2020:Ak7 UTSW 12 105745332 splice site probably null
R2267:Ak7 UTSW 12 105747214 missense probably benign
R3918:Ak7 UTSW 12 105710256 missense probably benign 0.03
R4600:Ak7 UTSW 12 105713575 missense probably benign 0.00
R4601:Ak7 UTSW 12 105713575 missense probably benign 0.00
R4602:Ak7 UTSW 12 105713575 missense probably benign 0.00
R4610:Ak7 UTSW 12 105713575 missense probably benign 0.00
R4611:Ak7 UTSW 12 105713575 missense probably benign 0.00
R4612:Ak7 UTSW 12 105761513 missense probably damaging 1.00
R4791:Ak7 UTSW 12 105710145 missense probably benign 0.05
R5523:Ak7 UTSW 12 105741082 nonsense probably null
R5911:Ak7 UTSW 12 105726212 missense probably damaging 1.00
R6066:Ak7 UTSW 12 105733491 missense possibly damaging 0.87
R6270:Ak7 UTSW 12 105768701 missense probably benign
R6767:Ak7 UTSW 12 105766607 missense probably damaging 0.98
R6960:Ak7 UTSW 12 105710244 missense probably benign
R7016:Ak7 UTSW 12 105781679 nonsense probably null
R7185:Ak7 UTSW 12 105742276 missense probably damaging 1.00
R7187:Ak7 UTSW 12 105745273 missense probably benign 0.00
R7204:Ak7 UTSW 12 105742243 missense probably benign
R7724:Ak7 UTSW 12 105716030 missense probably damaging 1.00
R7779:Ak7 UTSW 12 105742350 missense probably benign 0.42
R7878:Ak7 UTSW 12 105766749 missense probably damaging 1.00
R8375:Ak7 UTSW 12 105742341 missense probably damaging 0.99
R8752:Ak7 UTSW 12 105747217 small deletion probably benign
R8832:Ak7 UTSW 12 105742339 missense possibly damaging 0.75
R8980:Ak7 UTSW 12 105780899 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCTCCCATAAATAGCAGGTGCTC -3'
(R):5'- AACGTGAACCCTGTGCTCAGAC -3'

Sequencing Primer
(F):5'- TTTTGACGGAGATGACGGTC -3'
(R):5'- AGTGAGTTCCACAGACTTTACAC -3'
Posted On 2014-03-14