Incidental Mutation 'R1449:Dnah1'
ID 159167
Institutional Source Beutler Lab
Gene Symbol Dnah1
Ensembl Gene ENSMUSG00000019027
Gene Name dynein, axonemal, heavy chain 1
Synonyms E030034C22Rik, MDHC7, Dnahc1, B230373P09Rik
MMRRC Submission 039504-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1449 (G1)
Quality Score 178
Status Not validated
Chromosome 14
Chromosomal Location 31260375-31323896 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 31263951 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 3762 (N3762D)
Ref Sequence ENSEMBL: ENSMUSP00000043281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022458] [ENSMUST00000048603]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000022458
SMART Domains Protein: ENSMUSP00000022458
Gene: ENSMUSG00000021901

Pfam:Peptidase_C12 5 215 3e-70 PFAM
low complexity region 282 293 N/A INTRINSIC
low complexity region 396 407 N/A INTRINSIC
low complexity region 577 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000048603
AA Change: N3762D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043281
Gene: ENSMUSG00000019027
AA Change: N3762D

low complexity region 43 59 N/A INTRINSIC
Pfam:DHC_N2 998 1404 6.3e-146 PFAM
AAA 1558 1697 6.02e-1 SMART
AAA 1839 2077 4.66e0 SMART
low complexity region 2149 2157 N/A INTRINSIC
AAA 2204 2353 2.35e-1 SMART
Pfam:AAA_8 2533 2803 7.7e-84 PFAM
Pfam:MT 2815 3165 9.9e-57 PFAM
Pfam:AAA_9 3185 3410 1.1e-93 PFAM
Pfam:Dynein_heavy 3545 4246 2.7e-275 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228755
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inner dynein arm heavy chain that provides structural support between the radial spokes and the outer doublet of the sperm tail. Naturally occurring mutations in this gene are associated with primary ciliary dyskinesia and multiple morphological anomalies of the flagella that result in asthenozoospermia and male infertility. Mice with a homozygous knockout of the orthologous gene are viable but have reduced sperm motility and are infertile. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous mutants are male sterile, and show impaired ciliary and flagellar motility that is also observed in the tracheal cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A G 4: 137,455,355 N274D possibly damaging Het
6430571L13Rik T A 9: 107,342,490 N47K probably damaging Het
Aasdh C T 5: 76,886,289 A472T probably benign Het
Abca13 A G 11: 9,298,580 T2776A probably damaging Het
Adamts10 T A 17: 33,545,639 V711D probably damaging Het
Adrb3 G A 8: 27,227,387 R345C probably damaging Het
Ak7 T C 12: 105,742,261 V325A possibly damaging Het
Armc6 G A 8: 70,225,293 L129F probably benign Het
Bend6 T C 1: 33,878,343 N10S probably benign Het
Bmpr1b T C 3: 141,871,373 E59G possibly damaging Het
Brd3 A G 2: 27,450,251 probably null Het
Brd3 A G 2: 27,457,016 Y369H probably damaging Het
Cacna1e C T 1: 154,485,662 probably null Het
Camk4 A G 18: 32,939,475 D27G probably damaging Het
Camkk1 T G 11: 73,033,884 S308A probably damaging Het
Catsperb A G 12: 101,588,197 T717A probably benign Het
Cdh23 A T 10: 60,376,951 S1563R probably damaging Het
Cep44 A T 8: 56,540,950 S197R probably benign Het
Col3a1 T A 1: 45,321,611 I67N unknown Het
Dcaf12l1 T C X: 44,789,427 T165A probably benign Het
Dicer1 T C 12: 104,729,243 Y143C possibly damaging Het
Dlg5 A G 14: 24,135,643 I1898T possibly damaging Het
Dscaml1 A T 9: 45,742,223 T1382S possibly damaging Het
Entpd3 A T 9: 120,566,489 R513W probably damaging Het
Foxred1 A G 9: 35,209,442 S132P probably damaging Het
Ftsj3 T C 11: 106,253,000 I273V probably benign Het
Hsd17b7 C T 1: 169,959,682 probably null Het
Iars T A 13: 49,733,710 V1253D probably damaging Het
Iqsec1 T A 6: 90,690,808 K216* probably null Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Kcnk2 G A 1: 189,340,026 S35L probably benign Het
Kif13a T C 13: 46,812,736 Y402C probably damaging Het
Lamc1 A G 1: 153,250,495 S484P probably benign Het
Lap3 T C 5: 45,509,519 probably null Het
Lhx8 G T 3: 154,328,105 S46* probably null Het
Lin7a T C 10: 107,323,952 S42P probably damaging Het
Lrba G A 3: 86,354,278 R1513Q probably damaging Het
Maml2 C A 9: 13,620,684 P398Q possibly damaging Het
Mast2 T C 4: 116,309,013 I1201V probably damaging Het
Mmp20 A T 9: 7,642,768 D201V probably damaging Het
Morn5 T A 2: 36,057,080 C123* probably null Het
Mrpl4 A G 9: 21,007,511 K175E possibly damaging Het
Nav3 A T 10: 109,853,511 S302T probably benign Het
Ndrg2 T C 14: 51,908,134 Y217C probably damaging Het
Nfx1 A G 4: 40,976,803 D159G probably damaging Het
Nlrp9b A T 7: 20,023,164 T109S possibly damaging Het
Npepps A G 11: 97,207,154 Y909H probably benign Het
Olfr1510 A G 14: 52,410,567 C102R probably damaging Het
Olfr559 A T 7: 102,724,190 F100Y probably damaging Het
Olfr740 A G 14: 50,453,921 N290D probably damaging Het
Olfr801 T A 10: 129,670,369 D50V probably damaging Het
Olfr810 A C 10: 129,790,854 V245G probably damaging Het
Pcdh1 T C 18: 38,189,876 H968R probably damaging Het
Pde1b T A 15: 103,525,043 I296N probably damaging Het
Phldb1 T A 9: 44,716,633 T172S probably benign Het
Plxdc2 T C 2: 16,660,781 V215A possibly damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
Pou6f2 G T 13: 18,172,415 Q31K probably damaging Het
Psd T A 19: 46,324,811 Y40F probably damaging Het
Rnf126 T C 10: 79,761,614 N155D probably benign Het
Rpl36-ps3 C A 12: 12,912,031 noncoding transcript Het
Rrp15 C A 1: 186,736,268 V184F possibly damaging Het
Rslcan18 G T 13: 67,102,100 L24M possibly damaging Het
Sall1 A G 8: 89,032,483 I331T probably benign Het
Slamf7 A T 1: 171,641,038 N95K possibly damaging Het
Slc1a6 T C 10: 78,800,117 Y339H probably damaging Het
Slc39a8 A G 3: 135,826,685 N72D probably benign Het
Slf1 A G 13: 77,083,449 S604P probably damaging Het
Slfn4 C T 11: 83,188,993 T110M probably benign Het
Tnpo1 T C 13: 98,878,712 T116A probably damaging Het
Tor1b T C 2: 30,955,881 I190T probably damaging Het
Ttn C A 2: 76,969,794 E357* probably null Het
Tubg2 G T 11: 101,156,873 E95* probably null Het
Ubap2 A G 4: 41,209,351 probably null Het
Ube2i T C 17: 25,268,564 D67G possibly damaging Het
Ubxn11 A G 4: 134,124,892 E50G probably damaging Het
Wnk1 A G 6: 119,952,818 V1246A probably damaging Het
Zcchc7 A G 4: 44,929,124 T38A possibly damaging Het
Zfp236 A G 18: 82,646,005 S552P probably damaging Het
Other mutations in Dnah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Dnah1 APN 14 31287873 missense probably benign 0.01
IGL00227:Dnah1 APN 14 31286896 missense probably damaging 1.00
IGL00491:Dnah1 APN 14 31261839 missense probably damaging 1.00
IGL00787:Dnah1 APN 14 31300063 missense possibly damaging 0.91
IGL00809:Dnah1 APN 14 31300809 nonsense probably null
IGL00911:Dnah1 APN 14 31304434 splice site probably null
IGL00949:Dnah1 APN 14 31307090 missense probably benign 0.00
IGL00976:Dnah1 APN 14 31278138 missense probably damaging 1.00
IGL01484:Dnah1 APN 14 31299940 missense probably damaging 0.98
IGL01629:Dnah1 APN 14 31292320 missense probably damaging 1.00
IGL01716:Dnah1 APN 14 31263378 missense probably benign 0.34
IGL01893:Dnah1 APN 14 31266470 missense probably damaging 1.00
IGL01933:Dnah1 APN 14 31310915 missense probably benign 0.40
IGL01938:Dnah1 APN 14 31283887 missense probably benign
IGL02032:Dnah1 APN 14 31274369 missense probably benign
IGL02052:Dnah1 APN 14 31268786 missense probably damaging 0.99
IGL02097:Dnah1 APN 14 31305001 missense possibly damaging 0.92
IGL02127:Dnah1 APN 14 31304928 missense probably benign 0.00
IGL02143:Dnah1 APN 14 31283289 missense probably damaging 1.00
IGL02158:Dnah1 APN 14 31300967 missense probably benign 0.00
IGL02442:Dnah1 APN 14 31287878 missense probably damaging 1.00
IGL02525:Dnah1 APN 14 31305833 missense probably benign 0.05
IGL02558:Dnah1 APN 14 31274379 missense possibly damaging 0.96
IGL02633:Dnah1 APN 14 31284815 missense probably benign 0.05
IGL02720:Dnah1 APN 14 31262220 missense probably damaging 0.96
IGL02728:Dnah1 APN 14 31283998 missense probably benign 0.44
IGL02738:Dnah1 APN 14 31292640 missense probably benign 0.27
IGL02863:Dnah1 APN 14 31295293 missense probably damaging 0.99
IGL02944:Dnah1 APN 14 31300871 missense possibly damaging 0.88
IGL03110:Dnah1 APN 14 31266717 missense probably benign 0.40
IGL03201:Dnah1 APN 14 31300949 missense probably benign 0.13
IGL03215:Dnah1 APN 14 31274391 missense probably damaging 1.00
IGL03230:Dnah1 APN 14 31270066 missense probably damaging 1.00
IGL03248:Dnah1 APN 14 31269889 missense probably damaging 1.00
IGL03267:Dnah1 APN 14 31286588 missense probably benign 0.00
IGL03299:Dnah1 APN 14 31315122 nonsense probably null
IGL03301:Dnah1 APN 14 31292692 missense probably damaging 1.00
ergonomic UTSW 14 31300748 missense possibly damaging 0.91
Faraday UTSW 14 31310882 missense probably null 0.05
K3955:Dnah1 UTSW 14 31266459 missense probably benign
PIT1430001:Dnah1 UTSW 14 31262580 missense probably damaging 1.00
PIT4382001:Dnah1 UTSW 14 31284455 missense probably damaging 1.00
R0043:Dnah1 UTSW 14 31274405 missense probably damaging 0.97
R0092:Dnah1 UTSW 14 31271609 missense probably benign 0.00
R0100:Dnah1 UTSW 14 31262152 critical splice donor site probably null
R0100:Dnah1 UTSW 14 31262152 critical splice donor site probably null
R0101:Dnah1 UTSW 14 31283899 missense probably damaging 1.00
R0119:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0136:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0144:Dnah1 UTSW 14 31267874 splice site probably benign
R0279:Dnah1 UTSW 14 31302375 missense possibly damaging 0.94
R0299:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0316:Dnah1 UTSW 14 31278151 missense probably benign 0.00
R0739:Dnah1 UTSW 14 31265915 nonsense probably null
R0789:Dnah1 UTSW 14 31304591 missense probably benign
R0826:Dnah1 UTSW 14 31303907 missense probably benign 0.02
R1102:Dnah1 UTSW 14 31296457 nonsense probably null
R1116:Dnah1 UTSW 14 31307867 missense probably benign 0.13
R1229:Dnah1 UTSW 14 31310851 missense probably benign 0.11
R1447:Dnah1 UTSW 14 31306898 missense probably benign 0.06
R1462:Dnah1 UTSW 14 31268781 splice site probably benign
R1482:Dnah1 UTSW 14 31294874 missense probably damaging 1.00
R1500:Dnah1 UTSW 14 31316758 missense probably benign
R1512:Dnah1 UTSW 14 31293037 missense probably damaging 1.00
R1591:Dnah1 UTSW 14 31272332 missense probably benign 0.01
R1598:Dnah1 UTSW 14 31301262 missense probably benign 0.07
R1644:Dnah1 UTSW 14 31302292 splice site probably benign
R1672:Dnah1 UTSW 14 31276200 missense probably damaging 1.00
R1713:Dnah1 UTSW 14 31279182 missense probably damaging 1.00
R1769:Dnah1 UTSW 14 31310882 missense probably null 0.05
R1796:Dnah1 UTSW 14 31261093 missense probably benign 0.00
R1902:Dnah1 UTSW 14 31319759 missense probably damaging 0.99
R1903:Dnah1 UTSW 14 31319759 missense probably damaging 0.99
R1905:Dnah1 UTSW 14 31264630 missense probably benign 0.06
R1908:Dnah1 UTSW 14 31262558 missense probably damaging 1.00
R1972:Dnah1 UTSW 14 31265391 nonsense probably null
R1973:Dnah1 UTSW 14 31265391 nonsense probably null
R2004:Dnah1 UTSW 14 31301856 missense possibly damaging 0.79
R2051:Dnah1 UTSW 14 31279123 missense probably damaging 1.00
R2062:Dnah1 UTSW 14 31271129 missense probably damaging 1.00
R2188:Dnah1 UTSW 14 31279164 missense probably damaging 0.98
R2240:Dnah1 UTSW 14 31299974 missense probably benign 0.00
R2862:Dnah1 UTSW 14 31284762 missense probably benign 0.21
R2894:Dnah1 UTSW 14 31298761 missense possibly damaging 0.67
R3120:Dnah1 UTSW 14 31266822 nonsense probably null
R3410:Dnah1 UTSW 14 31269817 missense possibly damaging 0.55
R3411:Dnah1 UTSW 14 31269817 missense possibly damaging 0.55
R3435:Dnah1 UTSW 14 31316674 missense probably damaging 0.96
R3615:Dnah1 UTSW 14 31315148 missense possibly damaging 0.92
R3616:Dnah1 UTSW 14 31315148 missense possibly damaging 0.92
R3741:Dnah1 UTSW 14 31265467 splice site probably benign
R3805:Dnah1 UTSW 14 31294763 missense possibly damaging 0.67
R3894:Dnah1 UTSW 14 31307028 missense probably benign
R4007:Dnah1 UTSW 14 31303784 splice site probably benign
R4201:Dnah1 UTSW 14 31262270 missense probably benign 0.00
R4232:Dnah1 UTSW 14 31304916 missense probably benign
R4372:Dnah1 UTSW 14 31304922 missense probably damaging 1.00
R4391:Dnah1 UTSW 14 31294835 missense probably damaging 1.00
R4423:Dnah1 UTSW 14 31284761 missense probably benign 0.00
R4526:Dnah1 UTSW 14 31285998 missense probably benign 0.05
R4650:Dnah1 UTSW 14 31284887 splice site probably null
R4723:Dnah1 UTSW 14 31272942 missense probably damaging 1.00
R4748:Dnah1 UTSW 14 31319945 missense probably benign
R4783:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4784:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4785:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4843:Dnah1 UTSW 14 31264963 missense probably damaging 1.00
R4879:Dnah1 UTSW 14 31300748 missense possibly damaging 0.91
R4897:Dnah1 UTSW 14 31267539 missense probably damaging 1.00
R4911:Dnah1 UTSW 14 31295323 missense probably damaging 1.00
R4985:Dnah1 UTSW 14 31286898 missense probably null 1.00
R5070:Dnah1 UTSW 14 31282418 missense probably benign 0.05
R5128:Dnah1 UTSW 14 31296195 splice site probably null
R5409:Dnah1 UTSW 14 31263255 missense probably damaging 1.00
R5436:Dnah1 UTSW 14 31316747 missense probably benign
R5481:Dnah1 UTSW 14 31308871 missense possibly damaging 0.55
R5550:Dnah1 UTSW 14 31316708 missense probably benign 0.00
R5555:Dnah1 UTSW 14 31290819 missense probably damaging 0.99
R5566:Dnah1 UTSW 14 31274366 missense probably benign 0.35
R5623:Dnah1 UTSW 14 31286023 missense possibly damaging 0.62
R5701:Dnah1 UTSW 14 31274044 missense probably damaging 1.00
R5751:Dnah1 UTSW 14 31310906 missense probably benign 0.00
R5823:Dnah1 UTSW 14 31266418 missense possibly damaging 0.92
R6030:Dnah1 UTSW 14 31268027 missense probably damaging 1.00
R6030:Dnah1 UTSW 14 31268027 missense probably damaging 1.00
R6090:Dnah1 UTSW 14 31269425 missense possibly damaging 0.83
R6139:Dnah1 UTSW 14 31286027 missense probably benign 0.02
R6145:Dnah1 UTSW 14 31300970 missense probably benign 0.07
R6306:Dnah1 UTSW 14 31304587 missense probably damaging 0.97
R6376:Dnah1 UTSW 14 31275608 missense probably damaging 1.00
R6451:Dnah1 UTSW 14 31300808 missense probably benign 0.08
R6549:Dnah1 UTSW 14 31269383 missense probably damaging 1.00
R6748:Dnah1 UTSW 14 31299988 missense probably damaging 0.99
R6826:Dnah1 UTSW 14 31286290 missense probably benign 0.00
R6870:Dnah1 UTSW 14 31271061 nonsense probably null
R6932:Dnah1 UTSW 14 31287776 missense probably damaging 1.00
R6944:Dnah1 UTSW 14 31268904 missense probably damaging 1.00
R7033:Dnah1 UTSW 14 31264925 missense probably damaging 1.00
R7078:Dnah1 UTSW 14 31297110 missense probably damaging 1.00
R7133:Dnah1 UTSW 14 31286076 missense probably benign
R7136:Dnah1 UTSW 14 31298656 missense probably damaging 1.00
R7203:Dnah1 UTSW 14 31274382 missense probably benign
R7241:Dnah1 UTSW 14 31264939 missense probably benign 0.00
R7260:Dnah1 UTSW 14 31269386 missense probably damaging 1.00
R7264:Dnah1 UTSW 14 31269894 missense probably benign
R7291:Dnah1 UTSW 14 31298705 missense probably damaging 1.00
R7293:Dnah1 UTSW 14 31287863 missense probably damaging 1.00
R7300:Dnah1 UTSW 14 31269841 missense probably benign 0.05
R7319:Dnah1 UTSW 14 31296594 missense probably benign 0.02
R7323:Dnah1 UTSW 14 31298707 missense probably damaging 1.00
R7472:Dnah1 UTSW 14 31261590 missense probably damaging 1.00
R7472:Dnah1 UTSW 14 31300791 missense possibly damaging 0.80
R7499:Dnah1 UTSW 14 31315122 nonsense probably null
R7526:Dnah1 UTSW 14 31287876 missense possibly damaging 0.49
R7560:Dnah1 UTSW 14 31304983 missense probably benign
R7574:Dnah1 UTSW 14 31319908 missense probably benign 0.00
R7617:Dnah1 UTSW 14 31284782 missense possibly damaging 0.80
R7620:Dnah1 UTSW 14 31303906 missense possibly damaging 0.47
R7692:Dnah1 UTSW 14 31292338 missense probably benign 0.00
R7702:Dnah1 UTSW 14 31310909 missense probably benign
R7786:Dnah1 UTSW 14 31262521 missense probably damaging 1.00
R7984:Dnah1 UTSW 14 31267815 missense probably damaging 1.00
R8002:Dnah1 UTSW 14 31298722 missense probably damaging 1.00
R8022:Dnah1 UTSW 14 31265014 missense probably damaging 1.00
R8032:Dnah1 UTSW 14 31271548 missense probably damaging 1.00
R8099:Dnah1 UTSW 14 31302364 missense probably benign 0.00
R8171:Dnah1 UTSW 14 31297110 missense probably damaging 1.00
R8263:Dnah1 UTSW 14 31293177 missense probably damaging 1.00
R8274:Dnah1 UTSW 14 31295574 missense probably benign 0.00
R8345:Dnah1 UTSW 14 31264594 missense probably damaging 1.00
R8348:Dnah1 UTSW 14 31293725 missense probably damaging 1.00
R8353:Dnah1 UTSW 14 31283202 missense probably benign
R8356:Dnah1 UTSW 14 31273015 missense probably benign 0.00
R8376:Dnah1 UTSW 14 31301346 missense probably damaging 1.00
R8448:Dnah1 UTSW 14 31293725 missense probably damaging 1.00
R8461:Dnah1 UTSW 14 31305958 missense probably benign 0.00
R8534:Dnah1 UTSW 14 31301848 missense probably benign 0.16
R8544:Dnah1 UTSW 14 31268904 missense probably damaging 1.00
R8679:Dnah1 UTSW 14 31267810 missense possibly damaging 0.77
R8716:Dnah1 UTSW 14 31267984 critical splice donor site probably benign
R8750:Dnah1 UTSW 14 31304967 missense probably benign 0.30
R8790:Dnah1 UTSW 14 31296275 missense possibly damaging 0.89
R8808:Dnah1 UTSW 14 31286814 missense probably benign
R8821:Dnah1 UTSW 14 31296498 missense probably benign
R8887:Dnah1 UTSW 14 31311040 missense probably damaging 1.00
R8948:Dnah1 UTSW 14 31290439 missense probably damaging 1.00
R8950:Dnah1 UTSW 14 31290439 missense probably damaging 1.00
R8955:Dnah1 UTSW 14 31285993 missense probably benign
R8987:Dnah1 UTSW 14 31311747 missense possibly damaging 0.93
R8998:Dnah1 UTSW 14 31296278 missense probably benign 0.12
R8999:Dnah1 UTSW 14 31296278 missense probably benign 0.12
R9015:Dnah1 UTSW 14 31264359 missense probably damaging 0.96
R9031:Dnah1 UTSW 14 31279171 missense probably benign
R9088:Dnah1 UTSW 14 31266013 missense probably benign 0.04
R9096:Dnah1 UTSW 14 31261070 missense probably damaging 0.99
R9157:Dnah1 UTSW 14 31266013 missense probably damaging 0.97
R9296:Dnah1 UTSW 14 31274054 critical splice acceptor site probably null
R9313:Dnah1 UTSW 14 31266013 missense probably damaging 0.97
R9325:Dnah1 UTSW 14 31276203 missense possibly damaging 0.69
R9352:Dnah1 UTSW 14 31316663 missense probably benign 0.00
R9411:Dnah1 UTSW 14 31296299 missense probably damaging 1.00
R9429:Dnah1 UTSW 14 31275542 nonsense probably null
RF006:Dnah1 UTSW 14 31307875 missense probably benign 0.08
Z1088:Dnah1 UTSW 14 31304811 missense probably benign 0.17
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gggtgtggatgtgggaattg -3'
Posted On 2014-03-14